| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Istituto di Endocrinologia e Oncologia Sperimentale ‘G. Salvatore’-CNR and Dipartimento di Biologia e Patologia Cellulare e Molecolare, Università di Napoli Federico II, Via S. Pansini 5, 80131 Napoli, Italy
(Correspondence should be addressed to M Zannini; Email: s.zannini{at}ieos.cnr.it)
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionDeclaration of interestFundingReferences |
|---|
KxE), strongly conserved among mammals, amphibians, and fish. We demonstrated that Pax8 is sumoylated by the addition of a single small ubiquitin-like modifier (SUMO) molecule on its lysine residue 309 and that Pax8K309R, a substitution mutant in which the candidate lysine is replaced with an arginine, is no longer modified by SUMO. In addition, we analyzed whether protein inhibitor of activated signal transducers and activators of transcription (PIASy), a member of the PIAS STAT family of proteins, could function as a SUMO ligase and we demonstrated that indeed PIASy is able to increase the fraction of sumoylated Pax8. Interestingly, we show that Pax8 is targeted in the SUMO nuclear bodies, which are structures that regulate the nucleoplasmic concentration of transcription factors by SUMO trapping. Finally, we report here that the steady-state protein level of Pax8 is controlled by sumoylation.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionDeclaration of interestFundingReferences |
|---|
Despite the critical role played by Pax8 during thyroid development and differentiation, very little is known of its post-translational modifications and how these modifications may regulate its activity. Post-translational modifications like phosphorylation, acetylation, ubiquitination, and sumoylation represent a major mechanism by which transcription factors activity is regulated in eukaryotes (Hunter 2007). Recent studies have demonstrated that the TSH regulates Pax8 transcriptional activity (Mascia et al. 2002), but there isn't exhaustive evidence of post-translational modifications (Poleev et al. 1992, Kambe & Seo 1996).
In order to shed light on the mechanisms responsible for Pax8 post-translational regulation, we have investigated the role of sumoylation. Sumoylation is a dynamic and reversible process regulating (inhibiting or activating) gene expression by altering transcription factor stability, protein–protein interaction and subcellular localization of target proteins (Hay 2005, Heun 2007). Enzymes involved in small ubiquitin-like modifier (SUMO) conjugation have been identified both in yeast and in mammalian cells. While yeast and nematodes have a single SUMO gene, higher eukaryotes have three SUMO paralogues, SUMO-1, SUMO-2, SUMO-3, which are encoded by separate genes (Holmstrom et al. 2003). The mature forms of SUMO-2 and SUMO-3 are very similar, but less closely related to SUMO-1. Despite their close similarity, there is evidence that SUMO-1 and SUMO-2/3 are preferentially conjugated to distinct sets of target proteins. Furthermore, mouse embryos lacking SUMO-1 die, indicating that SUMO-2/3 cannot compensate for SUMO-1 deficiency. The small ubiquitin-related modifier SUMO-1 covalently modifies a growing list of proteins including c-Jun (Muller et al. 2000), cAMP response element-binding protein (Creb1; Kuo et al. 2005), Sp3 (Ross et al. 2002), GATA-1x (Collavin et al. 2004), glucocorticoid receptor (Tirard et al. 2007), c-Myc (Dahle et al. 2003), p300/CBP (Girdwood et al. 2003), and BMAL1 (Cardone et al. 2005).
The SUMO conjugation system is analogous to ubiquitination and involves machinery consisting of an E1-activating enzyme, an E2-conjugating enzyme (Ubc9), three different groups of E3-ligases to conjugate and several SUMO proteases to deconjugate SUMO from target proteins (Hay 2007, Zhao 2007). Whereas ubiquitination primarily mediates protein degradation, sumoylation appears to be involved in the regulation of diverse protein function such as gene expression, chromatin structure, nucleocytoplasmic traffic, and signal transduction (Melchior 2000, Muller et al. 2001, Seeler & Dejean 2003).
In the present study, we report that Pax8 is conjugated to SUMO and we map the single lysine residue involved in the modification. We also demonstrate that protein inhibitors of activated signal transducers and activators of transcription (PIAS STAT; Schmidt & Muller 2003, Shuai & Liu 2005), functions as a SUMO ligase for Pax8 and enhances Pax8 sumoylation. In addition, we show that Pax8 is targeted to the SUMO nuclear bodies (SNBs; Navascues et al. 2007) and that sumoylation affects the protein stability of Pax8.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionDeclaration of interestFundingReferences |
|---|
The plasmids used have been previously described and were as follows: CP5-CAT (Missero et al. 1998) CMV5-Pax8 (Zannini et al. 1992) and 3xFLAG-Pax8 (Di Palma et al. 2003). The mutants Pax8K309R, Pax8K2, Pax8K91R were constructed using the Quick Change XL Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA) as template to the CMV5-Pax8 construct. 3xFLAG-SUMO-1 and 3xFLAG-SUMO-
gly constructs were generated by PCR amplification of SUMO-1 rat cDNA using specific primers: SUMO-1Fw: 5'CCCAAGCTTGGGATGTCTGACCAGGAGGCAAAACCTTC3', SUMO-1Rev: 5'CGGGGTACCCCGCTAAACCGTCGAGTGACCCCCCGT3', and SUMO-1rev-mut: 5'cggggtaccccgctaaaccgtcgagtgagccgccgt3' and subsequent subcloning in the HindIII-KpnI sites of p3XFLAG-CMVTM-10 expression vector (Sigma, St Louis, MO, USA). The pCMV-T7-PIASy construct was kindly provided by Prof. Giannino del Sal.
Cell culture and transfection
PC Cl3 cells (Berlingieri et al. 1988) were grown in Coon's modified F-12 medium (Euroclone, Siziano, PV, Italy) supplemented with 5% calf serum and a six-hormone mixture (6H) as described by Ambesi-Impiombato & Coon (1979).
HeLa cells were grown in DMEM (Euroclone) supplemented with 10% FCS (Hyclone Logan, Utah, USA). For transient transfection experiments, cells were plated at 3x105 cells/60-mm tissue culture dish 10 to 12 h prior to transfection. Transfections were carried out with the FuGENE6 reagent (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's directions. The DNA/FuGENE ratio was 1:3 in all the experiments.
Transactivation assays
The plasmid CMV-LUC was used as the internal control and the total amount of transfected DNA was kept constant with an empty expression vector in all the transfection assays. Cell extracts were prepared 48 h after transfection to determine either the levels of the CAT protein with a CAT ELISA kit (Roche Diagnostics) or the LUC activity by a luciferase assay as previously described (de Wet et al. 1987). Transfection experiments were done in duplicate and repeated at least three times. CAT activity values on the graph are the means of all experiments (±) S.D. Statistical analysis has been performed by means of an unpaired two-tailed Student's t-test to obtain the P value associated with the observed fold of activation differences.
Protein extracts and immunoblotting
For reporter assays, cells were washed twice with ice-cold PBS and lysed in a buffer containing 10 mM Hepes pH 7.9, 400 mM NaCl, 0.1 mM EGTA pH 7.8, 5% glycerol, 1 mM DTT, 1 mM phenylmetilsulfonil fluoride (PMSF).
The protein concentration was determined using the Bio-Rad protein assay (Bio-Rad Laboratories Inc, Hercules, CA, USA).
For sumoylation assay, cells were washed in PBS and disrupted in SDS-Laemmli buffer with 10 mM N-ethylmaleimide (NEM) and boiled at 95 °C. Then the samples were analyzed by western blot.
For anti-T7-tag antibody co-immunoprecipitation, cells were harvested 48 h after transfection in 200 µl buffer, 150 mM NaCl, 50 mM Hepes at pH 7.5, 10% glycerol, 0,1% Tween 20, 10 mM NEM, 1 mM PMSF, and a complete protease inhibitor cocktail tablet (Roche). Cell debris was removed by centrifugation for 30 min. Lysates were first cleared with protein G beads for 30 min, followed by incubation with antibody for 1 h at 4 °C. Finally, the antibody complexes were captured with protein G beads for 1 h. Beads were washed four times with the same buffer and immunoprecipitates were analyzed by western blot.
For purification on anti-FLAG M2 agarose affinity gel (Sigma), 48 h after transfection cells were washed twice with PBS and lysed in RIPA buffer (150 mM NaCl, 10 mM Tris–HCl pH 7.2, 0,1% SDS, 1% TRITON X-100, 1% sodium deoxycholate, 5 mM EDTA pH 8, 10 mM NEM, 1 mM PMSF, and a complete protease inhibitor cocktail tablet). 1.5 mg total protein extract was purified on agarose affinity gel for 6 h at 4 °C on a rotating wheel. Bound proteins were eluted by resuspending the beads directly in 2X SDS-PAGE sample buffer and heating at 95 °C for 5 min.
For western blot analysis, proteins were separated on SDS-10% or 12% PAGE, gels were blotted onto Immobilon P (Millipore, Bredford, MA, USA) for 2 h and the membranes were blocked in 5% non-fat dry milk in Tris-buffered saline for 2 h or overnight before the addition of the antibody for 1 h. The primary antibodies used were anti-PAX8 (kindly provided by Di Lauro), anti-tubulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA), anti-FLAG (Sigma) and anti-T7 (Novagen, Madison, WI, USA). The filters were washed three times in Tris-buffered saline plus 0.5% Tween 20 before the addition of HRP-conjugated secondary antibodies for 45 min. HRP was detected with ECL (GE Healthcare, Waukesha, WI, USA).
Immunofluorescence analysis
HeLa and PC Cl3 cells were plated and cultured on 12 mm diameter glass coverslips 24 to 48 h prior to transfection with FuGENE6 reagent. Transfections were performed with 500 ng of each plasmid used and DNA/FuGENE ratio was 1:6 in all the experiments. Twenty-four hours after transfection, cells were fixed for 20 min at room temperature with a 4% solution of paraformaldehyde in PBS, treated for 20 min with 50 mM solution of NH4Cl in PBS, permeabilized for 5 min with a 0.5% solution of Triton X-100 in PBS and incubated for 60 min in 1% BSA in PBS. The coverslips were subsequently incubated for 60 min at room temperature with primary antibodies diluted in 1% BSA in PBS. After PBS washings, the coverslips were incubated for 30 min with Alexa 594-tagged goat anti-rabbit, and Alexa 488-tagged goat anti-mouse secondary antibodies diluted 1:200 in 1% BSA in PBS. After final washings with PBS, the coverslips were mounted on a microscope slide using a 50% solution of glycerol in PBS.
Primary antibody dilutions were the following: mouse monoclonal anti-flag 1:1000 (Sigma); rabbit polyclonal anti-Pax8 1:1000; mouse monoclonal anti-promyelocitic leukemia protein (PML; PG-M3) 1:200 (Santa Cruz). Confocal scanning laser microscopy images were collected with a Zeiss LSM 510 confocal laser scanning microscope, equipped with a 543 nm HeNe laser, a 488 nm argon ion laser and a Plan-Apochromat 63x/1.4 oil-immersion objective. Emitted fluorescence was detected using a BP 505–530 bandpass filter for Alexa Fluor 488 and a LP 560 long pass filter for Alexa Fluor 594. Pairs of images were collected simultaneously in the green and red channels. High magnification images were collected as 1024x1024x32 voxel images.
Electrophoretic mobility-shift assay
Double-stranded oligonucleotides corresponding to the rat Tg promoter, 5'-CACTGCCCAGTCAAGTGTTCTTGA-3' were labeled with 
-32P ATP and T4 polynucleotide kinase and used as probes. The binding reactions were carried out in a buffer containing 10 mM Hepes (pH 7.9), 10% glycerol, 0.1 mM EDTA, 8 mM MgCl2, 1 mM DTT, 0.15 µg/ml poly (dI-dC) for 30 min at room temperature. DNA–protein complexes were resolved on a 6% non-denaturing polyacrylamide gel and visualized by autoradiography.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionDeclaration of interestFundingReferences |
|---|
Protein sumoylation occurs on the lysine of a KxE protein motif (Song et al. 2004), where represents the hydrophobic residue isoleucine, leucine or valine and x is any amino acid. Analysis of the murine protein sequence of Pax8 (Genbank CAA40725) using the SUMO plot software from Abgent revealed the presence of two putative sumoylation sites at positions K91 and K309, representing a low score site (0.33) and an high score site (0.94) respectively. In agreement with these results, the putative site containing the lysine residue 91 is conserved only in mammals (data not shown), while the high score site centered on lysine 309 is strongly conserved among mammals (human, Genbank NP_003457), amphibians (Xenopus laevis, Genbank AAD52681), and fish (zebrafish Genbank AAC31813; Fig. 1).
|
|
To demonstrate that the higher-molecular-weight band indeed corresponds to sumoylated Pax8, we have transfected HeLa cells with the expression vectors encoding for Pax8 or PAX8K309R and 3xFLAG-SUMO-1. Cell lysates were immunoprecipitated with an anti-FLAG-agarose affinity gel and then analyzed by western blot with a polyclonal antibody against Pax8. As shown in Fig. 3, the higher-molecular-weight band was co-immunoprecipitated by anti-FLAG agarose affinity gel only in the extract prepared from cells expressing Pax8, further demonstrating that the sumoylation site in Pax8 is the lysine 309.
|
There are three families of SUMO E3 ligases. One of these consists of the members of the PIAS family that were originally identified as transcriptional coregulators of the JAK-STAT pathway. They contain a predicted RING-finger-like structure and bind to Ubc9 and selected SUMO target proteins. Mammals have at least five members: PIAS1, PIAS3, PIASxa, PIASxb, and PIASy (Schmidt & Muller 2003, Shuai & Liu 2005).
To investigate whether coexpression of one of the SUMO E3 ligases could increase Pax8 sumoylation, we cotransfected HeLa cells with the expression vectors encoding Pax8, 3xFLAG-SUMO-1 or 3xFLAG-SUMO-gly, and T7-PIASy. 3xFLAG-SUMO-gly is a mutated form of SUMO lacking the C-terminal glycine required for the attachment to the substrates. As shown in Fig. 4, a slower-migrating band is readily detected upon transfection of 3xFLAG-SUMO-1 (lane 2), and the intensity of the band is significantly increased by the coexpression of PIASy (lane 3), indicating that PIASy may function as an E3 ligase for Pax8. The slower-migrating band was not visible when Pax8 was cotransfected with the 3xFLAG-SUMO-gly mutant that is unable to bind the specific substrates (lane 4).
|
These data exclude the existence of latent low-affinity sumoylation sites and further confirm that lysine 309 is the only site required for SUMO attachment to Pax8.
We next asked whether PIASy might physically interact with Pax8. To address this point, we cotransfected HeLa cells with the expression vectors encoding 3xFLAG-Pax8 and T7-PIASy. Cell lysates were immunoprecipitated with an anti-T7 antibody and then analyzed by western blot with a monoclonal antibody against the FLAG epitope. Figure 5 shows that PIASy immunoprecipitates with Pax8, revealing an interaction between these two proteins. Moreover, this interaction is not dependent in the presence of sumoylatable lysine, since also Pax8K309R is able to bind PIASy (data not shown).
|
We next investigated the functional role of Pax8 sumoylation. Previous studies correlated SUMO modification with the recruitment of target proteins to specialized subnuclear domains. To address this issue, we transiently expressed 3xFLAG-SUMO-1 and Pax8 in HeLa cells and we followed their intracellular localization by confocal fluorescence microscopy. Double immunolabeling experiments with anti-FLAG and anti-Pax8 antibodies revealed that majority of the cells show a nuclear localization of PAX8 and SUMO-1 with a diffuse distribution, excluding areas that resemble nucleoli. Furthermore, immunofluorescence analysis revealed the presence of nuclear dots of different sizes that are positive for SUMO1 staining. Some of these dots, usually those of larger size, are also positive for Pax8 staining (Fig. 6A).
|
To assess if SUMO-1 needs to be in an active form in order to localize in SNBs we transiently expressed 3xFLAG-SUMO-gly and Pax8 in HeLa cells and we followed their intracellular localization by fluorescence microscopy (Fig. 6C). The mutated form of 3xFLAG-SUMO-gly showed a diffuse nucleoplasmic localization without a subnuclear concentration in nuclear bodies. These data indicate that only the active conjugating form of SUMO-1 is concentrated in SNBs.
To investigate the presence of SNBs in thyroid cells, we transfected PC Cl3 differentiated rat thyroid cells with 3xFLAG-SUMO-1 and we performed double immunolabeling experiments with anti-FLAG and anti-Pax8 antibodies to reveal the localization of endogenous Pax8. The confocal fluorescence microscopy analysis revealed, as already observed in HeLa cells, the presence of nuclear bodies positive for Pax8 and SUMO-1 indicating that the transcription factor Pax8 is targeted to SNBs also in thyroid cells (Fig. 7A). To investigate whether sumoylation of Pax8 is required for its localization in SNBs, we performed transient co-transfection in HeLa cells with the Pax8 mutant Pax8K309R and 3xFLAG-SUMO expression vectors. As shown in Fig. 7B, Pax8K309R colocalize with SUMO-1 in SNBs to a similar extent as wild-type Pax8. This observation suggests that PAX8 sumoylation is not necessary to target the protein to the SNBs.
|
To analyze the effect of sumoylation on Pax8 protein stability, we transfected a wide range of concentrations of plasmid-DNA expressing Pax8 or Pax8K309R in HeLa cells. As shown in Fig. 8, at equal amounts of transfected DNA, Pax8K309R showed significantly lower protein levels in total cell extracts compared with wild-type Pax8. These results suggest that the steady-state protein levels of the mutant protein were decreased.
|
To address this question, HeLa cells transfected with wild-type Pax8 or with Pax8K309R were treated with cycloheximide (CHX) for different times to block protein synthesis. In this way, it has been possible to follow the steady-state levels of proteins that had been synthesized before CHX treatment. After treatment, cells were lysed and proteins were subjected to western blot with a polyclonal antibody against Pax8. The quantification of the Pax8 band by densitometry revealed that the levels of Pax8 were more abundant than those of the Pax8 mutant (Fig. 9A). In addition, HeLa cells were cotransfected with PAX8 or Pax8K309R and with or without 3xFLAG-SUMO and 12 h after transfection the cells were treated with CHX for different times. The proteins were subjected to western blot with a polyclonal antibody against Pax8 and the quantification of the Pax8 band by densitometry revealed that the levels of wild-type Pax8 were increased when expressed with SUMO, while the same effect did not occur for Pax8K309R (Fig. 9B).
|
Transcriptional activity of Pax8K309R
To elucidate whether the attachment of SUMO to Pax8 might affect Pax8 transcriptional activity, we performed transactivation assays in HeLa cells co-transfecting the reporter construct CP5-CAT, an artificial promoter responsive only to Pax8, together with the expression vectors encoding for Pax8 or Pax8K309R. As expected, the cotransfection of wild-type Pax8 led to a significant activation of the CP5-CAT promoter (Fig. 10A). Inversely, the cotransfection of Pax8K309R showed a decreased transcriptional activation of the same promoter. Successively, we performed a western blot with a polyclonal antibody against Pax8 on the protein extracts of the transactivation assay described above. As shown in Fig. 10A, the results demonstrated that the decreased transcriptional activity of Pax8K309R corresponds to a reduced protein expression. To evaluate the ability of PAX8K309R to bind to DNA, we carried out electrophoretic mobility-shift assay (EMSA) using protein extracts prepared from HeLa cells transfected with the vectors encoding for Pax8 or Pax8K309R. Figure 10B shows that Pax8 and Pax8K309R bind with a similar affinity to the double-stranded oligonucleotide containing Pax8 consensus sequence. Taken together, these data further confirm that sumoylation affects Pax8 protein stability while it doesn't modify its transcriptional activity or its ability to bind DNA.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionDeclaration of interestFundingReferences |
|---|
We demonstrated that Pax8 is a substrate for SUMO modification, and we showed that lysine 309, which lies within a perfectly matching consensus sequence KxE, is the residue involved in this post-translational modification. Mutagenesis of lysine 309 completely abolishes Pax8 modification by SUMO, thus indicating that lysine 309 is the only sumoylation site in Pax8.
To further demonstrate that Pax8 is a substrate for sumoylation, we investigated whether coexpression of a SUMO E3 ligase was able to increase the fraction of sumoylated Pax8 and we identified PIASy as a potent SUMO ligase for Pax8. At the same time, we also showed that PIASy binds to Pax8 and that this interaction is not dependent on the presence of the sumoylatable lysine.
There is no simple way to predict which functional consequences the sumoylation of a given target might have. In fact, sumoylation is a highly dynamic process and its outcomes are multiple, ranging from changes in cellular localization to modification in the activity or stability of the modified protein. We investigated all these aspects in order to assign a functional role to Pax8 sumoylation. We addressed the question of the subcellular localization and we demonstrated that mutation of Pax8 sumoylation sites does not affect its subcellular localization. Interestingly, immunofluorescence analysis, in both non-thyroid and thyroid cells, revealed the presence of large size nuclear dots positive for Pax8 and SUMO staining. In parallel, we also demonstrated that Pax8 forms nuclear bodies colocalized with SUMO at the same extent of wild-type Pax8. Hence, we propose that Pax8 is targeted and sumoylated into the SNBs. It has been proposed that these structures might regulate the nucleoplasmic concentration of transcription factors by SUMO trapping (Navascues et al. 2007). Therefore, the macromolecular assembly of SUMO complexes into SNBs might lead to the stabilization of transcriptional factors in a nuclear compartment refractory to degradation. In this context, we hypothesized that Pax8K309R is targeted into SNBs as well as Pax8, but since it cannot be sumoylated it is degraded more rapidly. To assess this hypothesis, we investigated whether sumoylation could affect Pax8 protein stability and our data clearly show that indeed it does. The data of the role of sumoylation in the control of Pax8 stability were further confirmed by transactivation assays in HeLa cells. In fact, we demonstrated that the decreased transcriptional activity of Pax8K309R corresponds to a reduced protein expression, confirming that sumoylation affects protein stability of Pax8 and doesn't modify the transcriptional activity or the ability to bind DNA of Pax8.
In conclusion, we propose that Pax8 is sumoylated in SNBs that are nuclear bodies distinct from PML bodies, in which nuclear proteins may be organized and assembled. The macromolecular assembly of SUMO complexes into SNBs might lead to the stabilization of transcriptional regulators in a nuclear compartment refractory to degradation. The transcription factor Pax8 has been shown to be critically involved in determination and maintenance of the differentiation state of thyrocytes. Consequently, we think that the nucleoplasmic concentration of Pax8 may be a relevant aspect in the regulation of the expression of the thyroid-specific genes that are considered as markers of the differentiated phenotype. Interestingly, a variable regulation of Pax8 sumoylation might explain the marked differences in the phenotype of the subjects with Pax8 loss-of-function mutations. In fact, the penetrance/expressivity of Pax8 mutations has been shown to be variable, suggesting that other factors like a dominant negative effect or haploinsufficiency may modulate the phenotypic expression (Damante 1998, Macchia et al. 1998, de Sanctis et al. 2004). Hence, we would like to propose that a different state of Pax8 sumoylation caused by genetic and environmental factors could be an explanation for the phenotypic variability that occurs in patients carrying the mutations. Nevertheless, additional studies are now required to identify the physiological stimulus that controls Pax8 sumoylation. It is known that the expression of Pax8 is under the control of TSH/cAMP and that this control operates at a transcriptional level. Thus, it is possible that the same TSH/cAMP pathway or other physiological signals may be involved in the regulation of Pax8 post-translational modifications, modulating for example its nucleoplasmic concentration.
|
Declaration of interest |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionDeclaration of interestFundingReferences |
|---|
|
Funding |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionDeclaration of interestFundingReferences |
|---|
|
Acknowledgements |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionDeclaration of interestFundingReferences |
|---|
Berlingieri MT, Portella G, Grieco M, Santoro M & Fusco A 1988 Cooperation between the polyomavirus middle-T-antigen gene and the human c-myc oncogene in a rat thyroid epithelial differentiated cell line: model of in vitro progression. Molecular and Cellular Biology 8 2261–2266.
Cardone L, Hirayama J, Giordano F, Tamaru T, Palvimo JJ & Sassone-Corsi P 2005 Circadian clock control by SUMOylation of BMAL1. Science 309 1390–1394.
Collavin L, Gostissa M, Avolio F, Secco P, Ronchi A, Santoro C & Del Sal G 2004 Modification of the erythroid transcription factor GATA-1 by SUMO-1. PNAS 101 8870–8875.
Dahle O, Andersen TO, Nordgard O, Matre V, Del Sal G & Gabrielsen OS 2003 Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner. European Journal of Biochemistry 270 1338–1348.[Web of Science][Medline]
Damante G 1998 Thyroid defects due to Pax8 gene mutations. European Journal of Endocrinology 139 563–566.[CrossRef][Web of Science][Medline]
Girdwood D, Bumpass D, Vaughan OA, Thain A, Anderson LA, Snowden AW, Garcia-Wilson E, Perkins ND & Hay RT 2003 P300 transcriptional repression is mediated by SUMO modification. Molecular Cell 11 1043–1054.[CrossRef][Web of Science][Medline]
Hay RT 2005 SUMO: a history of modification. Molecular Cell 18 1–12.[CrossRef][Web of Science][Medline]
Hay RT 2007 SUMO-specific proteases: a twist in the tail. Trends in Cell Biology 17 370–376.[CrossRef][Web of Science][Medline]
Heun P 2007 SUMOrganization of the nucleus. Current Opinion in Cell Biology 19 350–355.[CrossRef][Web of Science][Medline]
Holmstrom S, Van Antwerp ME & Iniguez-Lluhi JA 2003 Direct and distinguishable inhibitory roles for SUMO isoforms in the control of transcriptional synergy. PNAS 100 15758–15763.
Hunter T 2007 The age of crosstalk: phosphorylation, ubiquitination, and beyond. Molecular Cell 28 730–738.[CrossRef][Web of Science][Medline]
Kambe F & Seo H 1996 Mediation of the hormone- and serum-dependent regulation of thyroglobulin gene expression by thyroid-transcription factors in rat thyroid FRTL-5 cells. Journal of Endocrinology 150 287–298.
Kuo HY, Chang CC, Jeng JC, Hu HM, Lin DY, Maul GG, Kwok RP & Shih HM 2005 SUMO modification negatively modulates the transcriptional activity of CREB-binding protein via the recruitment of Daxx. PNAS 102 16973–16978.
Macchia PE, Lapi P, Krude H, Pirro MT, Missero C, Chiovato L, Souabni A, Baserga M, Tassi V, Pinchera A et al. 1998 PAX8 mutations associated with congenital hypothyroidism caused by thyroid dysgenesis. Nature Genetics 19 83–86.[CrossRef][Web of Science][Medline]
Mansouri A, Chowdhury K & Gruss P 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nature Genetics 19 87–90.[CrossRef][Web of Science][Medline]
Mascia A, Nitsch L, Di Lauro R & Zannini M 2002 Hormonal control of the transcription factor Pax8 and its role in the regulation of thyroglobulin gene expression in thyroid cells. Journal of Endocrinology 172 163–176.[Abstract]
Melchior F 2000 SUMO-nonclassical ubiquitin. Annual Review of Cell and Developmental Biology 16 591–626.[CrossRef][Web of Science][Medline]
Meulmeester E & Melchior F 2008 Cell biology: SUMO. Nature 452 709–711.[CrossRef][Web of Science][Medline]
Missero C, Cobellis G, De Felice M & Di Lauro R 1998 Molecular events involved in differentiation of thyroid follicular cells. Molecular and Cellular Endocrinology 140 37–43.[CrossRef][Web of Science][Medline]
Muller S, Berger M, Lehembre F, Seeler JS, Haupt Y & Dejean A 2000 c-Jun and p53 activity is modulated by SUMO-1 modification. Journal of Biological Chemistry 275 13321–13329.
Muller S, Hoege C, Pyrowolakis G & Jentsch S 2001 SUMO, ubiquitin's mysterious cousin. Nature Reviews. Molecular Cell Biology 2 202–210.[CrossRef][Web of Science][Medline]
Navascues J, Bengoechea R, Tapia O, Vaque JP, Lafarga M & Berciano MT 2007 Characterization of a new SUMO-1 nuclear body (SNB) enriched in pCREB, CBP, c-Jun in neuron-like UR61 cells. Chromosoma 116 441–451.[CrossRef][Web of Science][Medline]
Di Palma T, Nitsch R, Mascia A, Nitsch L, Di Lauro R & Zannini M 2003 The paired domain-containing factor Pax8 and the homeodomain-containing factor TTF-1 directly interact and synergistically activate transcription. Journal of Biological Chemistry 278 3395–3402.
Pasca di Magliano M, Di Lauro R & Zannini M 2000 Pax8 has a key role in thyroid cell differentiation. PNAS 97 13144–13149.
Plachov D, Chowdhury K, Walther C, Simon D, Guenet JL & Gruss P 1990 Pax8, a murine paired box gene expressed in the developing excretory system and thyroid gland. Development 110 643–651.
Poleev A, Fickenscher H, Mundlos S, Winterpacht A, Zabel B, Fidler A, Gruss P & Plachov D 1992 PAX8, a human paired box gene: isolation and expression in developing thyroid, kidney and Wilms' tumors. Development 116 611–623.[Abstract]
Ross S, Best JL, Zon LI & Gill G 2002 SUMO-1 modification represses Sp3 transcriptional activation and modulates its subnuclear localization. Molecular Cell 10 831–842.[CrossRef][Web of Science][Medline]
de Sanctis L, Corrias A, Romagnolo D, Di Palma T, Biava A, Borgarello G, Gianino P, Silvestro L, Zannini M & Dianzani I 2004 Familial PAX8 small deletion (c.989_992delACCC) associated with extreme phenotype variability. Journal of Clinical Endocrinology and Metabolism 89 5669–5674.
Schmidt D & Muller S 2003 PIAS/SUMO: new partners in transcriptional regulation. Cellular and Molecular Life Sciences 60 2561–2574.[CrossRef][Web of Science][Medline]
Seeler JS & Dejean A 2003 Nuclear and unclear functions of SUMO. Nature Reviews. Molecular Cell Biology 4 690–699.[CrossRef][Web of Science][Medline]
Shuai K & Liu B 2005 Regulation of gene-activation pathways by PIAS proteins in the immune system. Nature Reviews. Immunology 5 593–605.[CrossRef][Web of Science][Medline]
Song J, Durrin LK, Wilkinson TA, Krontiris TG & Chen Y 2004 Identification of a SUMO-binding motif that recognizes SUMO-modified proteins. PNAS 101 14373–14378.
Stuart ET & Gruss P 1996 PAX: developmental control genes in cell growth and differentiation. Cell Growth and Differentiation 7 405–412.[Web of Science][Medline]
Tirard M, Almeida OF, Hutzler P, Melchior F & Michaelidis TM 2007 Sumoylation and proteasomal activity determine the transactivation properties of the mineralocorticoid receptor. Molecular and Cellular Endocrinology 268 20–29.[CrossRef][Web of Science][Medline]
de Wet JR, Wood KV, DeLuca M, Helinski DR & Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Molecular and Cellular Biology 7 725–737.
Zannini M, Francis-Lang H, Plachov D & Di Lauro R 1992 Pax-8, a paired domain-containing protein, binds to a sequence overlapping the recognition site of a homeodomain and activates transcription from two thyroid-specific promoters. Molecular and Cellular Biology 12 4230–4241.
Zhao J 2007 Sumoylation regulates diverse biological processes. Cellular and Molecular Life Sciences 64 3017–3033.[CrossRef][Web of Science][Medline]
Received in final form 29 September 2008
Accepted 30 October 2008
Made available online as an Accepted Preprint 30 October 2008
This article has been cited by other articles:
|
|
 |
|
  M. S. Cheong, H. C. Park, M. J. Hong, J. Lee, W. Choi, J. B. Jin, H. J. Bohnert, S. Y. Lee, R. A. Bressan, and D.-J. Yun Specific Domain Structures Control Abscisic Acid-, Salicylic Acid-, and Stress-Mediated SIZ1 Phenotypes Plant Physiology, December 1, 2009; 151(4): 1930 - 1942. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
-tubulin assessed the protein uniform loading and integrity (upper panel). Western blots were analyzed by densitometry and results of three independent experiments (±S.E.M.) were plotted (bottom panel). (B) HeLa cells were transfected with Pax8 or Pax8K309R and 3xFLAG-SUMO1. Twelve hours after transfection, cells were treated with 100 mg/ml cycloheximide (CHX) for the indicated time periods. The results of western blots were analyzed by densitometry and results of three independent experiments (±S.E.M.) were plotted.