|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Division of Cardiology, Armed Force Taichung General Hospital, Taichung, Taiwan, ROC2 Institute of Medical and Molecular Toxicology, Chung Shan Medical University, Taichung, Taiwan, ROC3 Department of Biological Science and Technology, China Medical University, Taichung 404, Taiwan, ROC4 Trauma and Emergency Center, China Medical University Hospital, Taichung 404, Taiwan, ROC5 Post-Baccalaureate School of Chinese Medicine, China Medical University, Taichung 404, Taiwan, ROC6 Department of Pediatrics, Medical Research and Medical Genetics, China Medical University, Taichung, Taiwan, ROC7 Division of Gastroenterology, Department of Internal Medicine, Armed Force, Taichung General Hospital, Taichung, Taiwan, ROC8 Institute of Biochemistry and Biotechnology, Chung Shan Medical University, Taichung 402, Taiwan, ROC9 Graduate Institute of Chinese Medical Science10 Institute of Basic Medical Science, China Medical University, Taichung 404, Taiwan, ROC11 Department of Health and Nutrition Biotechnology, Asia University, Taichung 413, Taiwan, ROC
(Correspondence should be addressed to C-H Chu who is now at Graduate Institute of Basic Medical Science, China Medical University, No. 91, Hsueh-Shih Road, Taichung 404, Taiwan, ROC; Email: s210001{at}smail.csmu.edu.tw)
* *W-J Wu, C-Y Huang and C-H Chu contributed equally to this work
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
IGF2R, a 300-kDa type I transmembrane glycoprotein, triggers various cellular functions by interacting with several distinct classes of ligands, including IGF-II and other proteins containing Man-6-P on carbohydrate side chains (Jones & Clemmons 1995). In a study of transgenic mice, the lack of an IGF-II/M6P receptor was associated with over proliferation of myocardial cells in ventricular hyperplasia (Lau et al. 1994). Furthermore, IGF2R protein ribozyme disruption protects cardiac myocytes against hypoxia- and TNF-induced apoptosis (Chen et al. 2004), suggesting that the IGF2R expression level in the heart has a vital role in the regulation of cardiac development, growth, and survival either in the embryo or in the adult. The classical function of IGF2R in the control of IGF-II concentrations through internalization and lysosomal degradation may suppress mitogenesis by reducing the availability of IGF-II, which binds to the IGF-I receptor (Jones & Clemmons 1995). Recently, it has been found that there is a putative G-protein binding site within the cytoplasmic domain of IGF2R and that IGF-II binding with IGF2R activates a G-protein sensitive-dependent pathway that contributes to a variety of physiological functions (Nishimoto et al. 1987, McKinnon et al. 2001, Hawkes et al. 2006). In our previous study, the upregulation of IGF-II and IGF2R genes were detected in rats made hypertensive by abdominal aorta ligation and H9c2 cardiomyoblast cells treated with ANGII (Lee et al. 2006). Based on these findings, we hypothesized that the binding of IGF-II to IGF2R might regulate myocardial remodeling through activating intracellular signaling.
We investigated whether IGF-II binding to IGF2R might be involved in myocardial remodeling through the regulation of ECM degrading enzymes. We found that IGF2R was aberrantly expressed in myocardial scar tissue. In our study on H9c2 cardiomyoblast cell cultures we used gelatin zymography to measure MMP-9 and MMP-2 activity in cells treated with IGF-I, IGF-II, and Leu27IGF-II, an IGF2R specifically binding IGF-II analog (Beukers et al. 1991). Treatment with both IGF-II and Leu27IGF-II, but not IGF-I, induced an increase in MMP-9 activity. Western blot revealed that treatment with Leu27IGF-II not only increased MMP-9, tPA, and uPA protein expression but also reduced TIMP-2 protein expression in H9c2 cardiomyoblast cells. The inhibition of IGF2R expression by siRNA blocked the IGF-II-induced MMP-9 activity.
Taken together, our findings suggested that the IGF2R signaling pathway may contribute to the progression of myocardial remodeling by disrupting the balance in MMP-9/TIMP-2 expression level and increasing PAs expression. Hopefully, the new insights provided by this study may be used to prevent chronic heart disease associated with fibrosis.
| Materials and methods |
|---|
|
|
|---|
Human cardiovascular tissue array (Provitro, Berlin, Germany) was immunostained with an anti-IGF2R antibody (SantaCruz Biotechnology, SantaCruz, CA, USA) using an Ultra Vision LP Detection System (Vector Laboratories, Burlingame, CA, USA) according to the manufacturer's instructions. The human cardiovascular tissue array was dried at 58 °C overnight following deparaffinization in xylene and hydrated using a graded series of ethanol. Endogenous peroxidase activity was blocked using hydrogen peroxide blocking buffer for 13 min. After rinsing in water for 15 min, the microarray slide was microwave treated in citrate buffer for 15 min, cooled at room temperature (RT) for 30 min and blocked with an ultra V blocking buffer for 5 min. The primary antibody directed against the peptides 1030–1209 in the rat IGF2R (1:100) was incubated for 30 min. The slide was incubated with primary antibody enhancing buffer at RT for 20 min. HRP Polymer was added and incubated at RT for 20 min. The IGF2R antibody was located using a universal secondary antibody formulation conjugated to an enzyme-labeled HRP Polymer. After staining with an appropriate substrate/chromogen for 5 min, the slide was counterstained with Harris hematoxylin, dehydrated through a graded series of ethanol to xylene washes, and coverslipped with permanent mounting media (Sigma Chemical). The polymer complex was then detected using microscopy (magnification 200x).
Cell culture
H9c2 cardiomyoblast cells were obtained from American Type Culture Collection (ATCC) and cultured in Dulbecco's modified essential medium supplemented with 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 1 mM pyruvate in humidified air (5% CO2) at 37 °C. H9c2 cells were cultured in serum-free medium for 12 h and then treated with or without IGF-I (10–8 M; Sigma Chemical), IGF-II (10–8 M; Sigma Chemical) or Leu27IGF-II (10–8 M; GroPep, Adelaide, Australia). After further incubation for 12 h or 24 h, the cells were harvested and extracted for analysis.
Protein extraction and western blot analysis
Cultured H9c2 cells were scraped and washed once with PBS. The cell suspension was then centrifuged and the cell pellets lysed for 30 min in lysis buffer (50 mM Tris, pH 7.5, 0.5 M NaCl, 1.0 mM EDTA, pH 7.5, 10% glycerol, 1 mM basal medium Eagle, 1% Igepal-630, and proteinase inhibitor cocktail tablet (Roche)) and centrifuged at 12 000 g for 10 min. The supernatants were removed and placed in new Eppendorf tubes for western blot analysis. Proteins from the H9c2 cell line were separated in 12% gradient SDS–PAGE and transferred onto nitrocellulose membranes. Nonspecific protein binding was blocked in blocking buffer at RT for 1 h (5% milk, 20 mM Tris–HCl, pH 7.6, 150 mM NaCl, and 0.1% Tween 20). The membranes were blotted with specific uPA (SantaCruz Biotechnology), Akt (SantaCruz Biotechnology), p-Akt (SantaCruz Biotechnology), tPA (SantaCruz Biotechnology), PAI-1 (SantaCruz Biotechnology), TGF-β (SantaCruz Biotechnology), MMP-9 (SantaCruz Biotechnology), MMP-2 (SantaCruz Biotechnology), TIMP-1 (SantaCruz Biotechnology), TIMP-2 (SantaCruz Biotechnology), and
-tubulin (SantaCruz Biotechnology) antibodies and incubated in 4 °C blocking buffer overnight. Densitometric analysis of immunoblots was performed using the AlphaImager 2200 digital imaging system (Digital Imaging System, CA, USA). Experiments were performed in triplicate.
Gelatin zymography
Cell mediums collected from H9c2 cardiomyoblast cells after treatment were diluted in non-reducing 2% (w/v) SDS sample buffer and electrophoresed on 10% polyacrylamide SDS gels containing 0.1% (w/v) gelatin (Sigma Chemical). After electrophoresis, gels were washed at RT for 2x30 min in 2.5% (v/v) Triton X-100 to remove SDS and incubated at 37 °C for 24 h in 50 mM Tris–HCl buffer, pH 7.5, containing 200 mM NaCl, and 5 mM CaCl2. After incubation, gels were stained for 30 min with 0.1% (w/v) G-250 Coomassie Blue in 45% (v/v) methanol, 10% (v/v) acetic acid glacial, and destained in the same solution without dye. All experiments were performed in triplicate.
Total RNA extraction and RT-PCR
Total RNA was extracted using the Ultraspec RNA isolation system (Biotecx Laboratories, Houston, TX, USA) according to directions supplied by the manufacturer. The RNA precipitate was washed twice using gentle vortexing with 70% ethanol, collected by centrifugation at 12 000 g, dried under vacuum for 5–10 min, dissolved in 50–100 µl diethylpyrocarbonate-treated water, and incubated for 10–15 min at 55–60 °C. cDNA was prepared in a buffer containing 50 mM Tris–HC1, pH 8.5, 30 mM KCl, 8 mM MgCl, 1 mM dithiothreitol, 0.25 mM each dCTP, dGTP, dTTP, and dATP, 20 U recombinant ribonuclease inhibitor, 1 pg random hexamers, 5 pg total RNA, and 40 U avian myeloblastosis virus reverse transcriptase in a volume of 20 pl. This mixture was incubated for 10 min at RT followed by 1 h at 42 °C to initiate cDNA synthesis. This mixture was then used for amplification of specific cDNAs by PCR. The PCR buffer contained 50 mM KCI, 10 mM Tris–HC1, pH 8.3, at 20 °C, 0.2 mM each dCTP, dGTP, dTMP, and dATP, 0.5 pM oligonucleotide PCR primers, 2.5 U Taq polymerase, and various MgCl concentrations in a final volume of 100 pl. Following the hot start (5 min at 95 °C, 80 °C hold), the samples were subjected to 35 cycles of 45 s at 95 °C, 2 min at 52 °C, and 45 s at 72 °C. For the MMP-9, TIMP-2, uPA, tPA and GAPDH primers, the primer annealing temperature was 56 °C. This was followed by a final extension step at 72 °C for 10 min. All RNA samples used were demonstrated to have intact 18S and 28S RNA bands on ethidium bromide-strained formaldehyde-agarose gels. Primers were as follows: rat MMP-9 forward primer CAGTTTGGTGTCGCGGAGCA, reverse primer AGGCCATGGGAGGTGCAGTG; rat TIMP-2 forward primer GGGTCTCGCTGGACGTTGGA, reverse primer AACTCCTGCTTCGGGGGTGC; rat uPA forward primer ACTCATCCCCACGCTGACCG, reverse primer AGTGGCCCTTACCCCACCCA; rat tPA forward primer ACACAGCGTGGAGGGCCAAC, reverse primer AGGATGCCTCATGCTTGCCG; rat GAPDH forward primer TCCCTCAAGATTGTCAGCAA, reverse primer AGATCCACAACGGATACA TT (MDBio, Taipei, Taiwan).
siRNA and transfection
Double-stranded siRNA sequences targeting IGF2R mRNAs were obtained from Dharmacon. A non-specific duplex (5'-CAGUGGAGAUCAACGUGCAAGUU-3'; Dharmacon) was used as a control. NRVM were plated in 100-mm well plates in DMEM without fetal bovine serum and transfected with double-stranded siRNA using the DharmaFECT Duo Transfection Reagent (Dharmacon) according to the manufacturer's instructions. To assess gene silencing, the IGF2R protein level was detected by immunoblotting.
Densitometry and statistical analysis
The relative protein intensities and MMP-2/9 activity were analyzed using the Digital Sciences 1D program from Kodak Scientific Imaging Systems (New Haven, CT, USA). All the results were expressed as means±S.D. or the means and coefficient of variation of three to five separate experiments as indicated. The transfection experiments were performed in triplicate. Standard curves were run and the data that were obtained fell within the linear range of the curve. In addition, all values were normalized to their respective lane load controls. The densitometric analysis of immunoblots and gelatin zymography in bar Fig. 5b were analyzed using one-way ANOVA with preplanned contrast comparisons against the control group (serum free) or against the IGF-II group. Results in Figs 2, 3b, d, 4b, d and 5a were analyzed by unpaired Student's t-test. In all cases, P<0.05 was considered significant.
|
|
| Results |
|---|
|
|
|---|
To examine the IGF2R protein expression level during myocardial remodeling, we performed immunochemistry analysis of human cardiovascular tissue array containing ten normal heart and ten myocardial scar tissues. Representative images demonstrating positive or negative myocardial scar staining compared with normal human heart tissue are shown in Fig. 1. A total of nine (45%) showed positive staining for IGF2R. Thus, 11 (55%) could be categorized as absent or minimal expression for IGF2R. Out of the myocardial scar samples, five showed strong expression of IGF2R (50%) and four showed moderate expression (40%). Only one out of the ten myocardial infarction samples appeared to have no more staining than normal heart tissue. None of the ten normal tissue samples on the slide showed any IGF2R overexpression. Overall, then, nine out of ten myocardial scars (90%) examined by immunohistochemistry showed significant overexpression of IGF2R. Taken together, our finding showed that the IGF2R was aberrantly expressed in myocardial infarction scars.
|
We investigated whether treatment with IGF-II would directly influence MMP-9 zymographic activity in H9c2 cardiomyoblast cells, and compared its effect with that of IGF-I. Representative gelatin zymography assays of culture mediums taken from H9c2 cardiomyoblast cells treated respectively with IGF-I and IGF-II. Gelatin zymography revealed, when compared with untreated controls, that there was a sixfold increase in MMP-9 activity, but not MMP-2, in cells treated with IGF-II (Fig. 2a and b). However, in cells treated with IGF-I, there was no difference between the MMP-9 and MMP-2 activities (Fig. 2a and b). Increased MMP-9 was detected only in the cells treated with IGF-II, indicating that IGF2R plays a crucial role in MMP-9 activity induction. Furthermore, using Leu27IGF-II to excludes other effects derived from insulin and IGF-I receptor. We attempted to clarify whether the IGF-II-induced MMP-9 activity is mediated through IGF2R. Western blots revealed treatment with IGF-I and IGF-II, but not Leu27IGF-II, increased AKT phosphorylation at 30 min (Fig. 2c), suggesting that Leu27IGF-II did not activate IGF-I receptor downstream effectors. Although the Leu27IGF-II function in MMP-9 activity induction within 24 h is similar to that of IGF-II, cells treated only with Leu27IGF-II for 12 h showed significantly elevated MMP-9 activity (Fig. 2d). Taken together, our finding indicated that IGF-II-induced MMP-9 activity occurs specifically through activating IGF2R signaling and that may be involved in myocardial remodeling.
Leu27IGF-II modulation of the MMP-9/TIMP-2 and PAs expression
To investigate whether the IGF2R signaling may regulate ECM degrading enzyme systems that contribute to myocardial fibrosis, we further used Leu27IGF-II to specifically activate IGF2R-deriving signaling and detection of MMPs, TIMPs, and PAs in the level of mRNA and protein in H9c2 cardiomyoblast cells. As can be seen in Figs 3 and 4, Leu27IGF-II significantly increased tPA, uPA, and MMP-9 expression and significantly reduced TIMP-2 expression in a time-dependent manner. It had no effect on MMP-2, TIMP-1, PAI-1, and TGF-β protein expression regulation (Figs 3a and b and 4a and b). Moreover, we performed the RT-PCR assay to detect the mRNA transcripts of tPA, uPA, MMP-9, and TIMP-2 in the H9c2 cardiomyoblast cells treated with Leu27IGF-II. The results in Figs 3c and d and 4c and d show a significant increase in the mRNA level of MMP-9, tPA, and uPA was detected in the cell treated with Leu27IGF-II, whereas the reduction in TIMP-2 mRNA was observed as well. The mRNA levels in the Leu27IGF-II treatment were consistent with protein results (Figs 3 and 4). All the results suggested that Leu27IGF-II may enhance the upregulation of tPA and uPA and induce the MMP-9 activity by disrupting the MMP-9/TIMP-2 balance.
|
|
To investigate whether IGF-II-induced MMP-9 activity might be through IGF2R, we further used IGF2R siRNA to disrupt the expression of IGF2R protein in H9c2 cardiomyoblast cells as treated with IGF-II. Western blots showed that there was significantly reduction in the IGF2R protein level in H9c2 cardiomyoblast cells transfected with IGF2R siRNA (Fig. 5a). As shown in Fig. 5b, we found a significantly greater reduction in the IGF-II-induced activity of MMP-9 in cells transfected with IGF2R siRNA than in cells treated with IGF-II alone. These findings indicated that IGF-II-induced MMP-9 activity was specifically through IGF2R.
| Discussion |
|---|
|
|
|---|
|
Previous investigations have reported that IGF2R involvement in ECM remodeling occurs through the proteolytic cleavage of latent TGF-β and plasminogen resulting in the activation of TGF-β and plasmin (Godar et al. 1999, Ghosh et al. 2003). We found a significant association between IGF2R over expression and myocardial scars (Fig. 1). Furthermore, our results indicated that both IGF-II and Leu27IGF-II, but not IGF-I, induced the increase in MMP-9 activity (Fig. 2). When the IGF2R expression was disrupted by siRNA, the IGF-II-induced MMP-9 activity was rescued (Fig. 5). Their results implied that in addition to trafficking IGF-II to lysosomal degradation, an intracellular signaling cascade could trigger IGF2R binding with IGF-II. Studies have found that through IGF2R signals cross-talk with the small G protein, they can influence several cellular behaviors, including calcium influx, acetylcholine (ACh) release, and cell migration by activating specific intracellular signaling cascades (Nishimoto et al. 1987, McKinnon et al. 2001, Hawkes et al. 2006). Consistent with our study and those previous investigations, we recommend that IGF2R may play a role in the architectural control of scar tissue formation by the proteolytic cleavage of latent TGF-β and plasminogen and also by regulating the intracellular signaling cascades. Further studies are needed to determine whether the activation of specific IGF2R signaling cascades in the heart occurs through the small G-protein-dependent pathway to affect the transcriptional regulation of ECM molecules such as MMPs, TIMPs, and PAs (Deschamps & Spinale 2006).
The ECM degrading enzyme systems degrade normal collagen structures, change ratios, organization, and cross-links among collagen types, resulting in the scarring process known as cardiac fibrosis (Li et al. 2000b, Cleutjens & Creemers 2002). Our results revealed that treatment with Leu27IGF-II, which specifically activated IGF2R signaling, disrupted the normal myocardial MMP-9/TIMP-2 levels (Fig. 3) and increased the expression of PAs (Fig. 4). One study by Ramos-DeSimone et al. (1999) found evidence that the plasminogen system acted as a MMP activity regulator in the heart. That study indicated the active plasmin induced MMP-3 to remove the carboxyl terminus of the proenzyme MMP-9, resulting in its activation (Lijnen et al. 1998, Ramos-DeSimone et al. 1999). The activation of IGF2R signaling might increase the expression of tPA and uPA (Fig. 4), which may in turn promote MMP-9 activity in the H9c2 cardiomyoblast cells (Fig. 2). Moreover, recent findings have shown that inhibition of MMPs or PAs can attenuate the dilatation of the left ventricle in mice with myocardial infarction (Li et al. 2000b, Peterson et al. 2001, Heymans et al. 2005), suggesting that the inhibition of IGF2R-deriving intracellular signals might be useful in preventing heart failure by regulating ECM remodeling balance.
In conclusion, the results of this study observed the role of IGF2R in intracellular signaling causing myocardial ECM remodeling by altering MMP-9, TIMP-2, and PA expression, and thereby potentially inducing MMP-9 activity. These new insights may be used into preventing chronic heart disease associated with fibrosis.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Beukers MW, Oh Y, Zhang H, Ling N & Rosenfeld RG1991[Leu27] insulin-like growth factor II is highly selective for the type-II IGF receptor in binding, cross-linking and thymidine incorporation experiments. Endocrinology1281201–1203.
Chen Z, Ge Y & Kang JX2004Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes. BMC Cell Biology515[CrossRef][Medline]
Cleutjens JP & Creemers EE2002Integration of concepts: cardiac extracellular matrix remodeling after myocardial infarction. Journal of Cardiac Failure8S344–S348.[CrossRef][Web of Science][Medline]
Deschamps AM & Spinale FG2006Pathways of matrix metalloproteinase induction in heart failure: bioactive molecules and transcriptional regulation. Cardiovascular Research69666–676.
Ducharme A, Frantz S, Aikawa M, Rabkin E, Lindsey M, Rohde LE, Schoen FJ, Kelly RA, Werb Z, Libby P et al.2000Targeted deletion of matrix metalloproteinase-9 attenuates left ventricular enlargement and collagen accumulation after experimental myocardial infarction. Journal of Clinical Investigation10655–62.[Web of Science][Medline]
Fay WP2004Plasminogen activator inhibitor 1, fibrin, and the vascular response to injury. Trends in Cardiovascular Medicine14196–202.[CrossRef][Web of Science][Medline]
Gaertner R, Jacob MP, Prunier F, Angles-Cano E, Mercadier JJ & Michel JB2005The plasminogen-MMP system is more activated in the scar than in viable myocardium 3 months post-MI in the rat. Journal of Molecular and Cellular Cardiology38193–204.[CrossRef][Web of Science][Medline]
Gallagher GL, Jackson CJ & Hunyor SN2007Myocardial extra cellular matrix remodeling in ischemic heart failure. Frontiers in Bioscience121410–1419.[CrossRef][Web of Science][Medline]
Ghosh P, Dahms NM & Kornfeld S2003Mannose 6-phosphate receptors: new twists in the tale. Nature Reviews. Molecular Cell Biology4202–212.[CrossRef][Web of Science][Medline]
Godar S, Horejsi V, Weidle UH, Binder BR, Hansmann C & Stockinger H1999M6P/IGFII-receptor complexes urokinase receptor and plasminogen for activation of transforming growth factor-beta1. European Journal of Immunology291004–1013.[CrossRef][Web of Science][Medline]
Hawkes C, Jhamandas JH, Harris KH, Fu W, MacDonald RG & Kar S2006Single transmembrane domain insulin-like growth factor-II/mannose-6-phosphate receptor regulates central cholinergic function by activating a G-protein-sensitive, protein kinase C-dependent pathway. Journal of Neuroscience26585–596.
Heymans S, Luttun A, Nuyens D, Theilmeier G, Creemers E, Moons L, Dyspersin GD, Cleutjens JP, Shipley M, Angellilo A et al.1999Inhibition of plasminogen activators or matrix metalloproteinases prevents cardiac rupture but impairs therapeutic angiogenesis and causes cardiac failure. Nature Medicine51135–1142.[CrossRef][Web of Science][Medline]
Heymans S, Lupu F, Terclavers S, Vanwetswinkel B, Herbert JM, Baker A, Collen D, Carmeliet P & Moons L2005Loss or inhibition of uPA or MMP-9 attenuates LV remodeling and dysfunction after acute pressure overload in mice. American Journal of Pathology16615–25.
Jones JI & Clemmons DR1995Insulin-like growth factors and their binding proteins: biological actions. Endocrine Reviews163–34.
Lau MM, Stewart CE, Liu Z, Bhatt H, Rotwein P & Stewart CL1994Loss of the imprinted IGF2/cation-independent mannose 6-phosphate receptor results in fetal overgrowth and perinatal lethality. Genes and Development82953–2963.
Leask A & Abraham DJ2004TGF-beta signaling and the fibrotic response. FASEB Journal18816–827.
Lee SD, Chu CH, Huang EJ, Lu MC, Liu JY, Liu CJ, Hsu HH, Lin JA, Kuo WW & Huang CY2006Roles of insulin-like growth factor II in cardiomyoblast apoptosis and in hypertensive rat heart with abdominal aorta ligation. American Journal of Physiology. Endocrinology and Metabolism291E306–E314.
Li YY, McTiernan CF & Feldman AM2000aInterplay of matrix metalloproteinases, tissue inhibitors of metalloproteinases and their regulators in cardiac matrix remodeling. Cardiovascular Research46214–224.
Li H, Simon H, Bocan TM & Peterson JT2000bMMP/TIMP expression in spontaneously hypertensive heart failure rats: the effect of ACE- and MMP-inhibition. Cardiovascular Research46298–306.
Lijnen HR, Silence J, Lemmens G, Frederix L & Collen D1998Regulation of gelatinase activity in mice with targeted inactivation of components of the plasminogen/plasmin system. Thrombosis and Haemostasis791171–1176.[Web of Science][Medline]
McKinnon T, Chakraborty C, Gleeson LM, Chidiac P & Lala PK2001Stimulation of human extra villous trophoblast migration by IGF-II is mediated by IGF type 2 receptor involving inhibitory G protein(s) and phosphorylation of MAPK. Journal of Clinical Endocrinology and Metabolism863665–3674.
Nishimoto I, Hata Y, Ogata E & Kojima I1987Insulin-like growth factor II stimulates calcium influx in competent BALB/c 3T3 cells primed with epidermal growth factor. Characteristics of calcium influx and involvement of GTP-binding protein. Journal of Biological Chemistry26212120–12126.
Odekon LE, Blasi F & Rifkin DB1994Requirement for receptor-bound urokinase in plasmin-dependent cellular conversion of latent TGF-β to TGF-β. Journal of Cellular Physiology158398–407.[CrossRef][Web of Science][Medline]
Peterson JT, Hallak H, Johnson L, Li H, O'Brien PM, Sliskovic DR, Bocan TM, Coker ML, Etoh T & Spinale FG2001Matrix metalloproteinase inhibition attenuates left ventricular remodeling and dysfunction in a rat model of progressive heart failure. Circulation1032303–2309.
Ramos-DeSimone N, Hahn-Dantona E, Sipley J, Nagase H, French DL & Quigley JP1999Activation of matrix metalloproteinase-9 (MMP-9) via a converging plasmin/stromelysin-1 cascade enhances tumor cell invasion. Journal of Biological Chemistry27413066–13076.
Schultz GA, Hahnel A, Arcellana-Panlilio M, Wang L, Goubau S, Watson A & Harvey M1993Expression of IGF ligand and receptor genes during preimplantation mammalian development. Molecular Reproduction and Development35414–420.[CrossRef][Web of Science][Medline]
Spinale FG2002Matrix metalloproteinases: regulation and dysregulation in the failing heart. Circulation Research90520–530.
Spinale FG, Coker ML, Heung LJ, Bond BR, Gunasinghe HR, Etoh T, Goldberg AT, Zellner JL & Crumbley AJ2000A matrix metalloproteinase induction/activation system exists in the human left ventricular myocardium and is upregulated in heart failure. Circulation1021944–1949.
Received in final form 15 May 2008
Accepted 20 May 2008
Made available online as an Accepted Preprint 20 May 2008
This article has been cited by other articles:
![]() |
A. W. Taylor Review of the activation of TGF-{beta} in immunity J. Leukoc. Biol., January 1, 2009; 85(1): 29 - 33. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |