|
|
||||||||
regulates several genes that control metabolism in skeletal muscle cells: links to modulation of reactive oxygen species production
1 Institute for Molecular Bioscience, University of Queensland St Lucia, 4072, Queensland, Australia
2 Departement dAtherosclerose, Institut Pasteur de Lille, Inserm, U545, Lille F-59019, France
3 Faculte de Pharmacie et Faculte de Medecine, Universite de Lille 2, Lille F-59019, France
(Requests for offprints should be addressed to G E O Muscat; Email: g.muscat{at}imb.uq.edu.au)
| Abstract |
|---|
|
|
|---|
(ROR
) is an orphan nuclear hormone receptor (NR) that is preferentially expressed in skeletal muscle and several other tissues, including pancreas, thymus, prostate, liver and testis. Surprisingly, the specific role of ROR
in skeletal muscle, a peripheral tissue, has not been examined. Muscle is one of the most energy demanding tissues which accounts for ~40% of the total body mass and energy expenditure, >75% of glucose disposal and relies heavily on ß-oxidation of fatty acids. We hypothesize that ROR
regulates metabolism in this major mass lean tissue. This hypothesis was examined by gain and loss of function studies in an in vitro mouse skeletal muscle cell culture model. We show that ROR
mRNA and protein are dramatically induced during skeletal muscle cell differentiation. We utilize stable ectopic over-expression of VP16-ROR
(gain of function), native ROR
and ROR
H12 (loss of function) vectors to modulate ROR
mRNA expression and function. Ectopic VP16 (herpes simplex virus transcriptional activator)-ROR
and native ROR
expression increases ROR
mRNA expression. Candidate-driven expression profiling of lines that ectopically express the native and variant forms of ROR
suggested that this orphan NR has a function in regulating the expression of genes that control lipid homeostasis (fatty acid-binding protein 4, CD36 (fatty acid translocase), lipoprotein lipase and uncoupling protein 3), carbohydrate metabolism (GLUT5 (fructose transporter), adiponectin receptor 2 and interleukin 15 (IL-15)) and muscle mass (including myostatin and IL-15). Surprisingly, the investigation revealed a function for ROR
in the pathway that regulates production of reactive oxygen species.
| Introduction |
|---|
|
|
|---|
The orphan nuclear receptor NR1F subgroup, retinoic acid receptor-related orphan receptor (ROR/RZR) includes three ROR/RZR genes; ROR
encodes four ROR
isoforms and is predominantly expressed in blood, brain, skeletal muscle and fat cells (Becker-Andre et al. 1993, Giguere et al. 1994). RORß/RZRß is expressed specifically in the brain (Carlberg et al. 1994), and ROR
encodes two isoforms ROR
1 and ROR
t. ROR
1 is preferentially expressed in skeletal muscle and several other tissues, including pancreas, thymus, prostate, liver and testis of human (Hirose et al. 1994, Ortiz et al. 1995). ROR
t isoform lacks 20 amino acids at amino terminus and is restricted to thymocytes (He et al. 1998).
The NR1F subgroup is closely related to the NR1D subgroup, including Rev-erb
, Rvr/Rev-erbß and the Drosophila orphan receptor, E75A, particularly in the DNA-binding domain and the putative ligand-binding domain. ROR, Rev-erb
and RVR bind as monomers to an asymmetric (A/T) 6 RGGTCA motif. ROR functions as a constitutive transactivator of gene expression, whereas Rev-erb
and RVR do not activate transcription, rather they mediate transcriptional repression, and can repress ROR
-mediated transactivation from this motif (Harding & Lazar 1993, Bonnelye et al. 1994, Dumas et al. 1994, Forman et al. 1994, Giguere et al. 1994, Retnakaran et al. 1994, Adelmant et al. 1996).
In vivo and in vitro (cell culture) genetic studies have implicated ROR
in the regulation of lipid homeostasis. First, NR1F1 (ROR
)-deficient mice have a dyslipidaemic phenotype, hypo-
-lipoproteinaemia, muscular atrophy and heightened inflammatory responses which lead to atherosclerosis (Vu-Dac et al. 1997, Mamontova et al. 1998, Raspe et al. 1999, Jetten & Ueda 2002, Jetten 2004). Secondly, ectopic over-expression of ROR
DE in a muscle cell culture model (Lau et al. 2004) leads to the modulation of genes involved in lipid absorption and ß-oxidation. ROR
(NR1F1) and Rev-erb
(NR1D1) opposingly regulate the expression of apolipoprotein CIII, a component of high density lipoprotein (HDL) and very low density lipoprotein (VLDL) that regulates triglyceride (TG) levels and lipoprotein lipase (LPL) activity (Vu-Dac et al. 1997, He et al. 1998, Mamontova et al. 1998, Raspe et al. 1999).
Characterization of ROR
/mice, identified several important immunological functions for ROR
, in the control of lymph node and Peyers patch development, thymopoiesis and T cell homeostasis. ROR
/ mice display increased apoptosis in the cortex of the thymus, and ROR
/ thymocytes placed in culture rapidly undergo apoptosis (Kurebayashi et al. 2000).
ROR
is highly expressed in skeletal muscle (Hirose et al. 1994). Muscle accounts for ~40% of the total body mass and energy expenditure, and > 75% of glucose disposal (Baron et al. 1988). This lean tissue relies heavily on ß-oxidation of fatty acids to supply the extreme energy demands of this organ. However, the fundamental role of ROR
in skeletal muscle lipid and energy homeostasis has not been addressed. We hypothesize that ROR
regulates metabolism in this major mass lean tissue. This hypothesis was tested by ectopic stable over-expression of ROR
gain and loss of function vectors in an in vitro mouse skeletal muscle cell culture model. These studies demonstrated that ROR
has a role in controlling the expression of genes that regulate muscle and fat mass (including myostatin and interleukin 15 (IL-15)), and lipid homeostasis (fatty acid-binding protein 4 (FABP4), CD36 and LPL). Unexpectedly, the study demonstrated a role for ROR
in the regulation of reactive oxygen species (ROS) production.
| Materials and methods |
|---|
|
|
|---|
Mouse myogenic C2C12 cells were cultured in growth medium called Dulbeccos modified Eagles medium (DMEM) supplemented with 10% heat-inactivated Serum Supreme (Cambrex Bio Science, Mt. Waverly, Victoria, Australia) in 6% CO2. Confluent myoblasts were differentiated into post-mitotic multinucleated myotubes by 5 days (MT5) of serum withdrawal (i.e. cultured in DMEM supplemented with 2% horse serum). Cells were harvested at the indicated time points, usually 24120 h (15 days) after mitogen withdrawal, unless indicated differently. African green monkey kidney COS-1 cells were grown in DMEM supplemented with 10% heat-inactivated fetal calf serum.
RNA extraction and cDNA synthesis
Total RNA was extracted from C2C12 cells using TRI-Reagent (SigmaAldrich) according to manufacturers protocol. Total RNA was then treated with 2 U Turbo DNase 1 (Ambion, Austin, TX, USA) at 37 °C for 30 min followed by purification of the RNA through an RNeasy purification column system (Qiagen). RNA was electrophoresed to determine the integrity of the preparation. SuperScript III was used to synthesize cDNA from 3 µg total RNA using random hexamers according to manufacturers instructions (Invitrogen). The cDNA was then diluted to 300 µl in nuclease-free water.
Protein extraction
Total soluble protein was extracted from C2C12 cells by the addition of lysis buffer (10 mM Tris (pH 8.0), 150 mM NaCl, 1% Triton X-100 and 5 mM EDTA) containing protease cocktail inhibitors (Rosch). Lysates were passed through a 26-gauge needle and centrifuged at 10 000 g for 20 min. The supernatant was collected and total protein concentration was determined by the bicinchoninic acid (BCA) as outlined by manufacturers instructions (Pierce Biotechnology Inc., Rockford, IL, USA).
Transient transfections
Each well of a 24-well plate of COS-1 cells (~60% confluence) was transfected with a total of ~0.61.0 µg of DNA per well using the liposome-mediated transfection procedure as described previously (Lau et al. 1999). Briefly, cells were transfected using an N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl-sulphate and metafectene (Biontex Laboratories GmbH, Munich, Germany) liposome mixture in 1x HBS (HEPES-buffered saline; 42 mM HEPES, 275 mM NaCl, 10 mM KCl, 0.4 mM Na2HPO4 and 11 mM dextrose (pH 7.1)). The DNA/N-[1-(2,3-dioleoyloxy)-propyl]-N,N,N-trimethylammonium methylsulphate/metafectene mixture was added to the cells in 0.50.6 ml DMEM supplemented with 10% fetal calf serum. The culture medium was changed 1624 h later and the cells were subsequently harvested for the assay of luciferase activity 48 h after the transfection period. Fold activation is expressed relative to activity obtained after co-transfection of the promoterreporter and pSG5/pNL-VP16 vectors only, arbitrarily set at 1. The mean fold activation values and S.D. were derived from a minimum of three independent triplicate experiments.
C2C12 stable transfection
Myogenic C2C12 cells, cultured in growth medium, were co-transfected with pSG5-ROR
H12, pSG5-ROR
and pNL-VP16-ROR
(and pCMVNEO at a 20:1 ratio of expression vector/NEO vector) by the liposome-mediated procedure in triplicates. The cells were then grown for another 24 h to allow cell recovery and neomycin resistance expression before G418 selection. After 10- to 14-day selection with 700 µg/ml G418 (Promega) in culture medium, the three independent polyclonal pools of stable transfectants were cultured and maintained on 300 µg/ml G418 medium.
Primers
Primers used for qPCR analysis of the mRNA populations have been described in detail (Lau et al. 2004), with the exception of primers designed for the detection of endogenous ROR
using SYBR green (endo ROR
forward, CCCGCCACTCTATAAGGAACTCT and endo ROR
reverse, AGGGCTGAAGGA AATAGAAAGTTGT).
Plasmids
pSG5-ROR
1, mPCP-2x4-tk-LUC(ROR
RE) containing four copies of mouse PCP-2 (GTTATAGTAACTGGGTCAGGGGACT) and pSG5 have been described previously (Lau et al. 2004). Mouse ROR
1 cDNAs were amplified from C2C12 total RNA using Pfu Turbo (Stratagene) as per manufacturers instructions and subsequently cloned into pBluescript. After DNA sequencing, this insert was cloned into eukaryotic expression vectors pSG5 and pNL-VP16. Subsequently, a truncated version of ROR
was amplified (coding 1494 aa) and cloned into pSG5 vectors and used as dominant negative form of ROR
. 7x(ROR
RE)-tk-LUC containing seven copies of ROR
RE (GGTAAGTAGGTCAT) was cloned into pTKLuc as described by Medvedev et al.(1996). The human LPL promoter (1980 bp) in pGL2 reporter vector was kindly provided by Dr Bart Staels (Schoonjans et al. 1996). The human Rev-erb
promoter (1733 bp) in pGL2 reporter vector was kindly provided by Dr Vincent Laudet (Adelmant et al. 1996). The mouse myogenin promoter (1565 bp) in pCAT reporter was kindly provided by Dr E N Olson (Edmondson et al. 1992) and, subsequently, it was sub-cloned into pGL2 reporter vector in our laboratory.
Quantitative real-time PCR (qPCR)
qPCR was performed on an ABI Prism 7500 sequence (detection system (Applied Biosystems, Foster city, CA, USA) in triplicate on three independent RNA preparations. Target cDNA levels were analysed in 25 µl reactions with either Syber Green or Taqman Technologies (Applied Biosystems). Primers (200 nM) used for the amplification of target gene sequences have been described in detail (Lau et al. 2004, Ramakrishnan et al. 2005). PCR was performed with 5 µl cDNA and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. The relative level of expression or fold change and associated errors were calculated using the guidelines described by Bookout & Mangelsdorf (2003) on the Nuclear Receptor Signaling Atlas website (NURSA; www.nursa.org/index.cfm) in accord with the accepted qPCR standards for the National Institutes of Health supported NURSA research.
Western blot analysis
Total soluble protein from the wild-type C2C12 myotubes stable pSG5-ROR
H12, pSG5-ROR
and pNL-VP16-ROR
C2C12 myotubes were resolved on a 10% SDSPAGE gel and transferred to a nitrocellulose membrane. The membranes were blocked overnight or for 1 h in 5% skimmed milk in TBSTween 20 followed by an overnight incubation with either ROR
(1:5000, Santa Cruz-28559; Santa Cruz Biotechnology Inc., Santa Cruz, CA, 95060, USA) or ROR
(1:2000, Santa Cruz 28612), and GAPDH (1:10 000; R&D Systems, Minneapolis, MN, USA) antibodies. Following 4x15-min washes, the membrane was incubated with anti-rabbit horseradish peroxidase (HRP) (1:2000) for 1 h. Immunoreactive signals were detected using enhanced chemiluminescence Super Signal West Pico Substrate (Pierce) and visualized by autoradiography on an XOMAT film developer (Kodak).
Measurement of ROS
Ten-thousand stable C2C12 cells/well were seeded in a 96-well view plate (PerkinElmer) and grown in normal cultured medium (DMEM) with 10% serum. Confluent myoblasts were differentiated into post-mitotic multi-nucleated myotubes by 5 days of serum withdrawal. Myotubes were loaded with 15 µM H2DCFDA (ROS probe, Invitrogen) in phenol red-free media for 30 min at 37 °C and fluorescence was measured. To induce ROS production, after loading ROS probe, we treated the cells with 50 µM H2O2 for about 30 min. The results obtained are from three independent polyclonal pools, assayed in triplicate.
Statistical analysis
Statistical analysis was performed on the average of three independent assays using Students t-test or one-way ANOVA, followed by either Tukeys or Dunnetts multiple comparison test.
| Results |
|---|
|
|
|---|
mRNA and protein are expressed in a differentiation-dependent manner during skeletal muscle differentiation
We initially investigated the expression of ROR
mRNA (and protein) relative to GAPDH in the mouse C2C12 in vitro skeletal muscle cell culture model. Proliferating myoblasts can be induced to biochemically and morphologically differentiate into post-mitotic multi-nucleated myotubes by mitogen withdrawal over several days. This transition from a non-muscle to a contractile phenotype is associated with the activation and repression of a structurally diverse group of genes that are responsible for the contractile and energy demands on this tissue. We utilized qPCR and western blot analysis to show that ROR
mRNA and protein expression (relative to GAPDH) increased during skeletal muscle cell differentiation (Fig. 1A
).
|
(mRNA and protein) expression was concomitant with the expression of several (muscle specific) contractile and metabolic markers. For example, qPCR demonstrated concomitant induction of myogenin mRNA (a gene that encodes the hierarchical basic helix loop regulator), slow (type I) and fast (type II) isoforms of the contractile protein troponin I (Fig. 1BD
VP16-ROR
and ROR
H12 operate as gain and loss of function vectors
To investigate the metabolic role of ROR
in skeletal muscle cells by gain and loss of function strategies, we proceeded to design vectors (for ectopic expression) that enhanced and/or attenuated ROR
expression function. In order to construct the constitutively activated ROR
(gain of function) vector, we cloned the VP16 transactivation domain (411456 aa) to the N-terminus of ROR
(Fig. 2A
). We utilized VP16-activated receptor because it still remains unknown whether a natural agonist/ligand exists for the ROR
nuclear orphan receptor. Hypothetically, this fusion would produce a hyperactive receptor. This approach has been used to mimic ligand/agonist-activated nuclear receptor (Schreiber et al. 2004, Wang et al. 2004). In addition, to perturb ROR
function and to disrupt ROR
-mediated gene expression, we constructed the ROR
H12 (dominant negative) expression vector. This construct encodes amino acids 1494 and consequently lacks helix12(H12) ofthe ligandbinding domain (LBD) that encodes the AF2 transactivation domain (Fig. 2A
). The AF2 domain contains the LYKELF aromatic amino acid residues and is conserved in all members of the ROR family. These aromatic amino acid residues are a crucial component for recruiting co-factors containing LXXLL motifs (Xie et al. 2005). To measure the ROR
-mediated transactivation on reporter gene, we constructed the heterologous reporter vector containing seven copies of ROR
E (GGTAAGTAGGTCAT) in pTKLuc (Medvedev et al. 1996).
|
vector (VP16-ROR
) significantly increased transactivation of the synthetic reporter in COS-1 cells relative to the native ROR
-mediated transactivation (Fig. 2B
-mediated transactivation of a heterologous reporter in COS-1 cells (Fig. 2C
-mediated transactivation of the synthetic reporter in a dose-dependent manner (Fig. 2D
Stable ectopic native ROR
, VP16-ROR
and ROR
H12 expression modulates endogenous ROR
mRNA expression
Further, native ROR
, VP16-ROR
and pSG5-ROR
H12 expression vectors were transfected into skeletal muscle cells, and polyclonal pools of cells (to avoid clonal bias) were isolated after 1014 days of G418 selection. Subsequently, wild-type C2C12 cells, C2:ROR
H12, native C2:ROR
and C2:VP16-ROR
cell lines were harvested after 5 days of serum withdrawal (n = 3). Initially, we measured total ROR
mRNA expression in these stably transfected cell lines relative to ROR
mRNA expression in wild-type C2C12 cells. The primers utilized measured total (i.e. both endogenous and ectopic) ROR
mRNA expression. This demonstrated that the stably transfected cell line expressed ~20-fold more ROR
mRNA. In contrast, western blot analysis indicated that ROR
protein levels did not correlate with the relative total mRNA levels (Fig. 3A
). In this context, studies have demonstrated that differential expression of mRNAs encoding contractile proteins in cardiac muscle is not reflected in protein levels (dos Remedios et al. 1996, Coumans et al. 1997). It should be noted that the antibody utilized cannot discriminate between endogenous (native) and exogenous hybrid ROR
proteins, and therefore reflects total protein levels.
|
mRNA expression were similar (and not significantly different) in the three stable cell lines, endogenous levels of ROR
transcripts were significantly reduced in the cell line expressing the dominant negative form of ROR
. Correspondingly, the lines that express native ROR
and constitutively active ROR
, displayed increased levels of endogenous ROR
transcripts (Fig. 3B
native ROR
and constitutively active ROR
.
Stable ectopic VP16-ROR
expression modulates myogenin mRNA expression
The cell lines that ectopically express the dominant negative, native and activated forms of ROR
cell lines were differentiated and retained the potential to morphologically differentiate. In order to confirm that the changes observed in these cell lines were not due to aberrant differentiation, we measured the levels of myogenic markers in RNA from differentiated cells. Comparable expression of the mRNAs encoding the sarcomeric slow troponin I (TNNI1) and fast troponin I (TNNI2) contractile proteins was observed in stable and wild-type myotubes (Fig. 4A and B
). Similar levels of myogenin transcripts were noticed in the lines that over-express the dominant negative and native forms of ROR
. Curiously, the line that over-expressed constitutively active ROR
showed significantly increased levels of myogenin mRNA expression (Fig. 4C
). However, as observed above the increased levels of myogenin mRNA did not impact on contractile protein mRNA expression.
|
and
) to transactivate the myogenin promoter. We transiently transfected COS-1 cells with the reporter plasmid containing 1565 bp of the myogenin promoter and examined the effect of co-transfected (exogenous) ROR
and ROR
expression. Interestingly, the myogenin promoter was significantly transactivated by ROR
(not ROR
) (Fig. 4D
Ectopic VP16-ROR
expression induces ROR
and Rev-erb
mRNA expression
We subsequently profiled the expression of several NRs involved in metabolism (Table 1
). This was performed to investigate whether ectopic over-expression of dominant negative, native and activated ROR
vectors altered the expression of other NRs.
|
were characterized by significantly increased expression of ROR
transcripts (Fig. 5A
induced significantly greater levels of ROR
, relative to native ROR
expression (Fig. 5A
regulates Rev-erb
expression (Delerive et al. 2002). Moreover, VP16-ROR
expression resulted in a corresponding increase in Rev-erb
mRNA expression. This suggested a threshold of ROR
expression may be required for the induction of Rev-erb
mRNA expression. Surprisingly, the dominant negative form of ROR
did not alter ROR
or Rev-erb
expression.
|
were relatively specific. For example, profiling of many NRs involved in the regulation of lipid homeostasis demonstrated the majority of relevant NRs were refractory to ectopic ROR
expression (Table 1
and LXRß, peroxisome proliferator activated receptor (PPAR)
, PPAR
and PPAR
was refractory to the effects of increased ROR
(and the corresponding changes in ROR
and Rev-erb
).
Previous studies have demonstrated that ROR
transactivates the Rev-erb
promoter (Delerive et al. 2002). Hence, we co-transfected the Rev-erb
promoter with ROR
and ROR
. This demonstrated that unlike ROR
, ROR
does not significantly transactivate the Rev-erb
promoter (Fig. 5C
). Moreover, it suggests that the increased Rev-erb
mRNA expression in these cells (i.e. C2:VP16-ROR
) is a reflection of increased ROR
(not ROR
) mRNA and protein expression.
Stable over-expression of dominant negative, native and activated ROR
vectors perturbs the expression of several genes in lipid and carbohydrate metabolism
We then examined each of the stable cell lines for changes in expression of critical genes involved in metabolism relative to wild-type C2C12 cells. Surprisingly, expression profiling analysis of the cell line that over-expressed the dominant negative form of ROR
(and resulted in suppression of endogenous ROR
mRNA expression) did not significantly affect programmes of gene expression that control metabolism of lipids and carbohydrates (Table 2
). Interestingly, expression profiling of the cell lines that exogenously expressed native ROR
and activated ROR
did reveal a functional (and distinct) role of ROR
in the regulation of metabolism.
|
and the activated ROR
leads to concordant effects on specific genes. For example, we observed significant activation of GLUT5 mRNA expression in the lines that exogenously expressed native ROR
and activated ROR
(Fig. 6A
|
(but not the native ROR
) resulted in increased expression of the adiponectin receptor 2 (AdipoR2) mRNA (Fig. 6B
Subsequently, we observed significant activation of IL-15 mRNA expression in the lines that ectopically over-express native ROR
and activated ROR
cell lines (Fig. 6C
). IL-15 is highly expressed in skeletal muscle and previous studies have demonstrated that IL-15 increases glucose utilization (Busquets et al. 2006) and administration of IL-15 to rats and mice inhibits white adipose tissue deposition (Quinn et al. 2005). In summary, several genes involved in carbohydrate metabolism were modulated by ectopic expression of native and activated ROR
.
In addition, we observed significant increases in myostatin (and IL-15) mRNA expression in the lines that ectopically over-express native ROR
and activated ROR
cell lines (Fig. 6C and D
). Myostatin is a negative regulator of muscle mass and positive regulator of adiposity (McPherron et al. 1997, Thomas et al. 2000). Moreover, IL-15 has anabolic effects on skeletal muscle protein synthesis both in vivo and in vitro (Quinn et al. 2005).
Furthermore, we observed that the expression of the mRNA encoding LPL (Fig. 6E
) was significantly enhanced in the lines transfected with the native and constitutively active ROR
. LPL is involved in preferential lipid utilization and TG hydrolysis. Subsequently, to understand the molecular mechanisms involved in the significant increase in LPL transcripts in the ROR
over-expressing lines, we analyzed the LPL promoter. We transiently transfected COS-1 cells with reporter plasmid containing 1980 bp of LPL promoter and examined the reporter activity after co-transfection of exogenous ROR
and ROR
plasmids. Interestingly, LPL was significantly transactivated by ROR
(not ROR
; Fig. 6F
). Thus, we speculate that LPL expression is modulated by ROR
expression in skeletal muscle cells.
The expression of the mRNAs encoding CD36 and FABP4 (involved in fatty acid and oxysterol absorption) was significantly attenuated in the stably over-expressing activated ROR
cell line relative to the wild type. Surprisingly, the over-expression of the dominant negative and native ROR
vectors resulted in increased CD36 and FABP4 mRNA expression (Fig. 7A and B
).
|
and activated ROR
suggested that this orphan NR is involved in the regulation of lipid and carbohydrate homeostasis, and the control of muscle mass. However, the latter observations (Fig. 7A and B
and the activated ROR
lead to either opposite or similar effects (for example, see 6A vs 7A) on specific genes. There are a number of possible explanations. As discussed previously, it still remains unknown whether a natural agonist/ligand exists for ROR
and this coupled to the observation that agonist-dependent NRs can function as repressors in the absence of ligand complicates the interpretation of native NR over-expression. The issue is further convoluted by several observations that underscore the permutations associated with NR-mediated regulation: i) loss of LXR in mice leads to derepression (increased expression) of ABCA1, a classical target gene, whereas another target gene, SREBP-1c remains silenced (Wagner et al. 2003); ii) agonist activation of PPAR
and PPAR
can lead to transcriptional repression (Lee et al. 2003, Ghisletti et al. 2007); and iii) orphan NRs (e.g. chicken ovalbumin upstream promotor transcriptional factor (COUP-TF)) have been reported to function as either activators and repressors of transcription, or accessory factors. These observations can be partially explained by differential co-repressor/coactivator recruitment and displacement in gene- and cell-specific manner.
ROR
gain and loss of function studies identify a role for ROR
in the regulation of UCP3 mRNA expression and ROS production
We further investigated the physiological role of ROR
in skeletal muscle cells by measuring steady-state ATP levels, the rate of fatty acid oxidation and ROS production. Surprisingly, we did not observe any significant change in fatty acid oxidation and total ATP content (data not shown) in the stably over-expressing dominant negative, native and activated ROR
cell lines relative to wild-type C2C12 cells.
Additional expression profiling revealed that the expression of the mRNA encoding UCP3 (Fig. 8A
) was significantly increased in the cell line over-expressing VP16-ROR
. UCPs are inner mitochondrial membrane transporters that uncouple substrate oxidation from ATP synthesis, converting fuel to heat. However, many studies have suggested that UCP3 is involved in preferential lipid utilization and modulation of ROS production in skeletal muscle cells. UCP3 knockout mice and adenoviral over-expression in skeletal muscle cells have demonstrated that aberrant UCP3 expression effects ROS production (Vidal-Puig et al. 2000, MacLellan et al. 2005). We investigated whether VP16-ROR
mediated increases in UCP3 mRNA expression in skeletal muscle cells, altered ROS levels relative to the wild-type (and dominant negative) ROR
expression in C2C12 cells. Interestingly, the line that over-expressed ectopic-activated ROR
showed a significant decrease in endogenous and (hydrogen peroxide (H2O2)) induced ROS production relative to the dominant negative and wild-type cells (Fig. 8B
).
|
| Discussion |
|---|
|
|
|---|
has a distinct role in lipid metabolism. For example, ROR
-deficient mice develop severe atherosclerosis, hypo-
-lipoproteinaemia, hypotriglyceridaemia, muscular atrophy and heightened inflammatory responses (Vu-Dac et al. 1997, Mamontova et al. 1998, Raspe et al. 1999, Jetten & Ueda 2002, Jetten 2004). In concordance, in vitro cell culture studies indicated that ROR
regulates the expression of genes involved in lipid homeostasis in skeletal muscle cells (Lau et al. 2004).
Although, ROR
is highly expressed in skeletal muscle (a major mass peripheral metabolic tissue), the functional role of this orphan NR in metabolism has not been explored. We utilized the C2C12 skeletal muscle cell culture model to investigate whether ROR
regulates genetic programmes implicated in metabolism. This in vitro model system is robust and data derived from the analysis of differentiated post-mitotic multinucleated myotubes with LXR and PPAR
agonists have been validated/reproduced in mice (Muscat et al. 2002, Dressel et al. 2003, Holst et al. 2003, Wang et al. 2004).
We probed ROR
function in skeletal muscle cells by stable ectopic expression of vectors that encode dominant negative, native and activated ROR
. The experiments indicated that the ROR
dominant negative vector in skeletal muscle cells significantly repressed the endogenous levels of the ROR
transcripts, and ROR
-dependent gene expression. However, we did not observe any significant change in gene expression involved in metabolism. This is consistent with the phenotype of ROR
-deficient mice that appear normal in the context of lipid and carbohydrate homeostasis.
Interestingly, we observed that ectopic over-expression of activated ROR
significantly increased the expression of ROR
and Rev-erb
mRNA. These observations are consistent with the previous reports demonstrating that ROR
directly transactivates the Rev-erb
promoter (Delerive et al. 2002).
In the context of carbohydrate metabolism, we observed the lines expressing native and activated ROR
expressed significantly elevated levels of GLUT5 mRNA. This transcript is increased in skeletal muscle and repressed in adipose in the insulin-resistant diabetic state (Litherland et al. 2004) and normalized by pioglitazone therapy. Concordantly, we noted a significant increase in IL-15 mRNA expression that encodes a cytokine expressed in skeletal muscle which induces glucose uptake and oxidation (Busquets et al. 2006).
Exogenous expression of the VP16-ROR
in skeletal muscle cells resulted in the significant elevation of transcripts encoding UCP3, which correlated with attenuated production of ROS. UCPs are inner mitochondrial membrane transporters that uncouple substrate oxidation from ATP synthesis, converting fuel to heat. However, UCP3 has been implicated in the transport of fatty acid anions (Himms-Hagen & Harper 2001) and regulating the accumulation of ROS (Vidal-Puig et al. 2000). For example, reduced UCP3 expression has been linked to increased ROS production (Vidal-Puig et al. 2000). Moreover, increased expression minimizes ROS production (MacLellan et al. 2005). In this context, decreased UCP3 expression in skeletal muscle is associated with insulin resistance in diabetic individuals (Schrauwen et al. 2001, Patti et al. 2003, Houstis et al. 2006). Increased ROS production may critically damage cell membranes and reduce mitochondrial number. In the course of mitochondrial respiration, increased ROS production may lead to deleterious changes in transmembrane potential. Therefore, UCP3 may influence energy expenditure because of a secondary effect on the integrity of the mitochondria (Schrauwen & Hesselink 2002).
We also demonstrated that the expression of mRNA which encodes myostatin, a negative regulator of skeletal muscle mass and positive regulator of adiposity, is significantly increased in the stable lines which ectopically express native and activated ROR
(McPherron et al. 1997). In this context, we observe elevated levels of IL-15 that have been demonstrated to have anabolic effects in muscle, and decrease white adipose tissue mass in rodents (Quinn et al. 2005). In summary, it appears that ROR
modulates genes involved in the regulation of muscle and adipose mass.
Notably, over-expression of native ROR
and chimeric VP16-ROR
implicated the orphan NR in the regulation of lipid metabolism. For example, in the ROR
gain of function cell lines, we observed elevated LPL mRNA expression. LPL is a rate-limiting enzyme, which hydrolyses the TG-rich lipoproteins into fatty acids in skeletal muscle. Furthermore, we demonstrated that ROR
(but not ROR
) transactivates the LPL promoter. In the context of lipid homeostasis, we observed significant repression of CD36 and FABP4 mRNAs (that encode proteins involved in fatty acid absorption) in the VP16-ROR
cell line. Whether ROR
regulates the LPL promoter by primary (direct) and/or secondary mechanisms remain unclear at present. Future studies utilizing ChIP, deletion and EMSA analysis will be used to address these questions.
These latter observations raise questions about the complex mechanisms that mediate the sometimes apparently disparate effect of ectopic native ROR
versus activated ROR
expression in skeletal muscle cells on a subset of target genes. One clear explanation is that VP16-ROR
(but not native ROR
) expression activates both ROR
and Rev-erb
. These are opposingly acting NRs that respectively function as activators and repressors of transcription. This expression pattern of NRs may account for the contrasting effects of native and VP16-ROR
over-expression in skeletal muscle cells. In addition, differential effects of either NR gain or loss of function on specific targets are not unforeseen paradoxes. As discussed previously, it is not clear whether ROR
is modulated by natural compounds (Stehlin-Gaon et al. 2003), and this impacts on whether the NR can be additionally modulated. For example, oestrogen-related receptors can function independently of ligands, but retain the capacity to modulate by agonists and antagonists (Kamei et al. 2003, Rodriguez-Calvo et al. 2006). Furthermore, gain and loss of NR function can differentially effect target genes (LXR, PPAR
and COUP-TF) due to differential cofactor recruitment and displacement in diverse cells and tissues (Lee et al. 2003, Wagner et al. 2003).
In conclusion, we suggest that ROR
in the skeletal muscle cells controls several programmes of gene expression that have important roles in the control of muscle growth, lipid and carbohydrate metabolism. Moreover, we present evidence that this orphan NR may modulate mitochondrial function via the UCP3-mediated regulation of ROS production.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
responsive element located in the human Rev-erb
promoter mediates a repressing activity. PNAS 93 35533558.Baron AD, Brechtel G, Wallace P & Edelman SV 1988 Rates and tissue sites of non-insulin- and insulin-mediated glucose uptake in humans. American Journal of Physiology 255 E769E774.[Web of Science][Medline]
Becker-Andre M, Andre E & DeLamarter JF 1993 Identification of nuclear receptor mRNAs by RT-PCR amplification of conserved zinc-finger motif sequences. Biochemical and Biophysical Research Communications 194 13711379.[CrossRef][Web of Science][Medline]
Bonnelye E, Vanacker JM, Desbiens X, Begue A, Stehelin D & Laudet V 1994 Rev-erbß, a new member of the nuclear receptor superfamily, is expressed in the nervous system during chicken development. Cell Growth & Differentiation 5 13571365.[Abstract]
Bookout AL & Mangelsdorf DJ 2003 Quantitative real-time PCR protocol for analysis of nuclear receptor signaling pathways. Nuclear Receptor Signaling 1 e012.[Medline]
Busquets S, Figueras M, Almendro V, Lopez-Soriano FJ & Argiles JM 2006 Interleukin-15 increases glucose uptake in skeletal muscle. An antidiabetogenic effect of the cytokine. Biochimica et Biophysica Acta 1760 16131617.[Medline]
Carlberg C, Hooft van Huijsduijnen R, Staple JK, DeLamarter JF & Becker-Andre M 1994 RZRs, a new family of retinoid-related orphan receptors that function as both monomers and homodimers. Molecular Endocrinology 8 757770.
Coumans JV, Yeoh T, Seeto RK, Keogh A, Brennan K, Gunning P, Hardeman E & dos Remedios CG 1997 Variations in the relative mRNA levels of actins and myosin heavy chains do not produce corresponding differences in their proteins in the adult human heart. Journal of Molecular and Cellular Cardiology 29 895905.[CrossRef][Web of Science][Medline]
Delerive P, Chin WW & Suen CS 2002 Identification of Reverb(alpha) as a novel ROR(alpha) target gene. Journal of Biological Chemistry 277 3501335018.
Dressel U, Allen TL, Pippal JB, Rohde PR, Lau P & Muscat GE 2003 The peroxisome proliferator-activated receptor beta/delta agonist, GW501516, regulates the expression of genes involved in lipid catabolism and energy uncoupling in skeletal muscle cells. Molecular Endocrinology 17 24772493.
Dumas B, Harding HP, Choi HS, Lehmann KA, Chung M, Lazar MA & Moore DD 1994 A new orphan member of the nuclear hormone receptor superfamily closely related to Rev-Erb. Molecular Endocrinology 8 9961005.
Edmondson DG, Cheng TC, Cserjesi P, Chakraborty T & Olson EN 1992 Analysis of the myogenin promoter reveals an indirect pathway for positive autoregulation mediated by the muscle-specific enhancer factor MEF-2. Molecular and Cellular Biology 12 36653677.
Forman BM, Chen J, Blumberg B, Kliewer SA, Henshaw R, Ong ES & Evans RM 1994 Cross-talk among ROR
1 and the Rev-erb family of orphan nuclear receptors. Molecular Endocrinology 8 12531261.
Ghisletti S, Huang W, Ogawa S, Pascual G, Lin ME, Willson TM, Rosenfeld MG & Glass CK 2007 Parallel SUMOylation-dependent pathways mediate gene- and signal-specific transrepression by LXRs and PPAR
. Molecular Cell 25 5770.[CrossRef][Web of Science][Medline]
Giguere V, Tini M, Flock G, Ong E, Evans RM & Otulakowski G 1994 Isoform-specific amino-terminal domains dictate DNA-binding properties of ROR
, a novel family of orphan hormone nuclear receptors. Genes and Development 8 538553.
Harding HP & Lazar MA 1993 The orphan receptor Rev-ErbA
activates transcription via a novel response element. Molecular and Cellular Biology 13 31133121.
He YW, Deftos ML, Ojala EW & Bevan MJ 1998 ROR
t, a novel isoform of an orphan receptor, negatively regulates Fas ligand expression and IL-2 production in T cells. Immunity 9 797806.[CrossRef][Web of Science][Medline]
Himms-Hagen J & Harper ME 2001 Physiological role of UCP3 may be export of fatty acids from mitochondria when fatty acid oxidation predominates: an hypothesis. Experimental Biology and Medicine 226 7884.
Hirose T, Smith RJ & Jetten AM 1994 ROR
: the third member of ROR/RZR orphan receptor subfamily that is highly expressed in skeletal muscle. Biochemical and Biophysical Research Communications 205 19761983.[CrossRef][Web of Science][Medline]
Holst D, Luquet S, Nogueira V, Kristiansen K, Leverve X & Grimaldi PA 2003 Nutritional regulation and role of peroxisome proliferator-activated receptor delta in fatty acid catabolism in skeletal muscle. Biochimica et Biophysica Acta 1633 4350.[Medline]
Houstis N, Rosen ED & Lander ES 2006 Reactive oxygen species have a causal role in multiple forms of insulin resistance. Nature 440 944948.[CrossRef][Medline]
Jetten AM 2004 Recent advances in the mechanisms of action and physiological functions of the retinoid-related orphan receptors (RORs). Current Drug Targets Inflammation and Allergy 3 395412.[CrossRef]
Jetten AM & Ueda E 2002 Retinoid-related orphan receptors (RORs): roles in cell survival, differentiation and disease. Cell Death and Differentiation 9 11671171.[CrossRef][Web of Science][Medline]
Kamei Y, Ohizumi H, Fujitani Y, Nemoto T, Tanaka T, Takahashi N, Kawada T, Miyoshi M, Ezaki O & Kakizuka A 2003 PPAR
coactivator 1beta/ERR ligand 1 is an ERR protein ligand, whose expression induces a high-energy expenditure and antagonizes obesity. PNAS 100 1237812383.
Kurebayashi S, Ueda E, Sakaue M, Patel DD, Medvedev A, Zhang F & Jetten AM 2000 Retinoid-related orphan receptor gamma (ROR
) is essential for lymphoid organogenesis and controls apoptosis during thymopoiesis. PNAS 97 1013210137.
Lau P, Bailey P, Dowhan DH & Muscat GE 1999 Exogenous expression of a dominant negative ROR
1 vector in muscle cells impairs differentiation: ROR
1 directly interacts with p300 and myoD. Nucleic Acids Research 27 411420.
Lau P, Nixon SJ, Parton RG & Muscat GE 2004 ROR
regulates the expression of genes involved in lipid homeostasis in skeletal muscle cells: caveolin-3 and CPT-1 are direct targets of ROR. Journal of Biological Chemistry 279 3682836840.
Lee CH, Chawla A, Urbiztondo N, Liao D, Boisvert WA, Evans RM & Curtiss LK 2003 Transcriptional repression of atherogenic inflammation: modulation by PPARdelta. Science 302 453457.
Litherland GJ, Hajduch E, Gould GW & Hundal HS 2004 Fructose transport and metabolism in adipose tissue of Zucker rats: diminished GLUT5 activity during obesity and insulin resistance. Molecular and Cellular Biochemistry 261 2333.[CrossRef][Web of Science][Medline]
MacLellan JD, Gerrits MF, Gowing A, Smith PJ, Wheeler MB & Harper ME 2005 Physiological increases in uncoupling protein 3 augment fatty acid oxidation and decrease reactive oxygen species production without uncoupling respiration in muscle cells. Diabetes 54 23432350.
Mamontova A, Seguret-Mace S, Esposito B, Chaniale C, Bouly M, Delhaye-Bouchaud N, Luc G, Staels B, Duverger N, Mariani J et al. 1998 Severe atherosclerosis and hypoalphalipoproteinemia in the staggerer mouse, a mutant of the nuclear receptor ROR
. Circulation 98 27382743.
McPherron AC, Lawler AM & Lee SJ 1997 Regulation of skeletal muscle mass in mice by a new TGF-ß superfamily member. Nature 387 8390.[CrossRef][Medline]
Medvedev A, Yan ZH, Hirose T, Giguere V & Jetten AM 1996 Cloning of a cDNA encoding the murine orphan receptor RZR/ROR
and characterization of its response element. Gene 181 199206.[CrossRef][Web of Science][Medline]
Muscat GE, Wagner BL, Hou J, Tangirala RK, Bischoff ED, Rohde P, Petrowski M, Li J, Shao G, Macondray G et al. 2002 Regulation of cholesterol homeostasis and lipid metabolism in skeletal muscle by liver X receptors. Journal of Biological Chemistry 277 4072240728.
Ortiz MA, Piedrafita FJ, Pfahl M & Maki R 1995 TOR: a new orphan receptor expressed in the thymus that can modulate retinoid and thyroid hormone signals. Molecular Endocrinology 9 16791691.
Patti ME, Butte AJ, Crunkhorn S, Cusi K, Berria R, Kashyap S, Miyazaki Y, Kohane I, Costello M, Saccone R et al. 2003 Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: potential role of PGC1 and NRF1. PNAS 100 84668471.
Quinn LS, Strait-Bodey L, Anderson BG, Argiles JM & Havel PJ 2005 Interleukin-15 stimulates adiponectin secretion by 3T3-L1 adipocytes: evidence for a skeletal muscle-to-fat signaling pathway. Cell Biology International 29 449457.[CrossRef][Web of Science][Medline]
Ramakrishnan SN, Lau P, Burke LJ & Muscat GE 2005 Rev-erbß regulates the expression of genes involved in lipid absorption in skeletal muscle cells: evidence for cross-talk between orphan nuclear receptors and myokines. Journal of Biological Chemistry 280 86518659.
Raspe E, Madsen L, Lefebvre AM, Leitersdorf I, Gelman L, Peinado-Onsurbe J, Dallongeville J, Fruchart JC, Berge R & Staels B 1999 Modulation of rat liver apolipoprotein gene expression and serum lipid levels by tetradecylthioacetic acid (TTA) via PPAR
activation. Journal of Lipid Research 40 20992110.
dos Remedios CG, Berry DA, Carter LK, Coumans JV, Heinke MY, Kiessling PC, Seeto RK, Thorvaldson T, Trahair T, Yeoh T et al. 1996 Different electrophoretic techniques produce conflicting data in the analysis of myocardial samples from dilated cardiomyopathy patients: protein levels do not necessarily reflect mRNA levels. Electrophoresis 17 235238.[CrossRef][Web of Science][Medline]
Retnakaran R, Flock G & Giguere V 1994 Identification of RVR, a novel orphan nuclear receptor that acts as a negative transcriptional regulator. Molecular Endocrinology 8 12341244.
Rodriguez-Calvo R, Jove M, Coll T, Camins A, Sanchez RM, Alegret M, Merlos M, Pallas M, Laguna JC & Vazquez-Carrera M 2006 PGC-1ß down-regulation is associated with reduced ERR
activity and MCAD expression in skeletal muscle of senescence-accelerated mice. Journals of Gerontology. Series A, Biological Sciences and Medical Sciences 61 773780.[Web of Science]
Schoonjans K, Peinado-Onsurbe J, Lefebvre AM, Heyman RA, Briggs M, Deeb S, Staels B & Auwerx J 1996 PPAR
and PPAR
activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO Journal 15 53365348.[Web of Science][Medline]
Schrauwen P & Hesselink M 2002 UCP2 and UCP3 in muscle controlling body metabolism. Journal of Experimental Biology 205 22752285.
Schrauwen P, Hesselink MK, Blaak EE, Borghouts LB, Schaart G, Saris WH & Keizer HA 2001 Uncoupling protein 3 content is decreased in skeletal muscle of patients with type 2 diabetes. Diabetes 50 28702873.
Schreiber SN, Emter R, Hock MB, Knutti D, Cardenas J, Podvinec M, Oakeley EJ & Kralli A 2004 The estrogen-related receptor alpha (ERR
) functions in PPAR
coactivator 1alpha (PGC-1alpha)-induced mitochondrial biogenesis. PNAS 101 64726477.
Stehlin-Gaon C, Willmann D, Zeyer D, Sanglier S, Van Dorsselaer A, Renaud JP, Moras D & Schule R 2003 All-trans retinoic acid is a ligand for the orphan nuclear receptor RORß. Nature Structural Biology 10 820825.[CrossRef][Web of Science][Medline]
Stuart CA, Howell ME & Yin D 2007 Overexpression of GLUT5 in diabetic muscle is reversed by pioglitazone. Diabetes Care 30 925931.
Thomas M, Langley B, Berry C, Sharma M, Kirk S, Bass J & Kambadur R 2000 Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. Journal of Biological Chemistry 275 4023540243.
Vidal-Puig AJ, Grujic D, Zhang CY, Hagen T, Boss O, Ido Y, Szczepanik A, Wade J, Mootha V, Cortright R et al. 2000 Energy metabolism in uncoupling protein 3 gene knockout mice. Journal of Biological Chemistry 275 1625816266.
Vu-Dac N, Gervois P, Grotzinger T, De Vos P, Schoonjans K, Fruchart JC, Auwerx J, Mariani J, Tedgui A & Staels B 1997 Transcriptional regulation of apolipoprotein A-I gene expression by the nuclear receptor ROR
. Journal of Biological Chemistry 272 2240122404.
Wagner BL, Valledor AF, Shao G, Daige CL, Bischoff ED, Petrowski M, Jepsen K, Baek SH, Heyman RA, Rosenfeld MG et al. 2003 Promoter-specific roles for liver X receptor/corepressor complexes in the regulation of ABCA1 and SREBP1 gene expression. Molecular and Cellular Biology 23 57805789.
Wang YX, Zhang CL, Yu RT, Cho HK, Nelson MC, Bayuga-Ocampo CR, Ham J, Kang H & Evans RM 2004 Regulation of muscle fiber type and running endurance by PPARdelta. PLoS Biology 2 e294.[CrossRef][Medline]
Xie H, Sadim MS & Sun Z 2005 ROR
t recruits steroid receptor coactivators to ensure thymocyte survival. Journal of Immunology 175 38003809.
Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M et al. 2003 Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423 762769.[CrossRef][Medline]
Received in final form 20 March 2007
Accepted 28 April 2007
Made available online as an Accepted Preprint 3 May 2007
This article has been cited by other articles:
![]() |
I. Gerin, G. T. Bommer, M. E. Lidell, A. Cederberg, S. Enerback, and O. A. MacDougald On the Role of FOX Transcription Factors in Adipocyte Differentiation and Insulin-stimulated Glucose Uptake J. Biol. Chem., April 17, 2009; 284(16): 10755 - 10763. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Douard and R. P. Ferraris Regulation of the fructose transporter GLUT5 in health and disease Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E227 - E237. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Quinn Interleukin-15: A muscle-derived cytokine regulating fat-to-lean body composition J Anim Sci, April 1, 2008; 86(14_suppl): E75 - E83. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |