JME Society for Endocrinology Archive
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Molecular Endocrinology (2007) 39 17-28    DOI: 10.1677/JME-06-0054
© 2007 Society for Endocrinology

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quignodon, L.
Right arrow Articles by Flamant, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quignodon, L.
Right arrow Articles by Flamant, F.

A combined approach identifies a limited number of new thyroid hormone target genes in post-natal mouse cerebellum

Laure Quignodon, Carmen Grijota-Martinez1, Emmanuel Compe2, Romain Guyot, Nathalie Allioli, David Laperrière4, Robert Walker3, Paul Meltzer3, Sylvie Mader4, Jacques Samarut and Frédéric Flamant

Institut de Génomique Fonctionnelle de Lyon, Ecole Normale Supérieure de Lyon, Université de Lyon, UMR INRA CNRS 5242, IFR128 46 allée d’Italie, 69364 Lyon Cedex 07, France
1 Instituto de Investigaciones Biomédicas Alberto Sols (CSIC-UAM) and Center for Biomedical Research on Rare Diseases (CIBERER), 28029 Madrid, Spain
2 Institut de Génétique et de Biologie Moléculaire et Cellulaire, Illkirch, France
3 Cancer Genetics Branch, NHGRI, Bethesda, Maryland, USA
4 Institut de recherche en Immunologie et Cancer, Université de Montréal, Montréal H3C3J7, Quebec, Canada

(Requests for offprints should be addressed to F Flamant; Email: frederic.flamant{at}ens-lyon.fr)


    Abstract
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
Thyroid hormones act directly on gene transcription in the post-natal developing cerebellum, controlling neuronal, and glial cell differentiation. We have combined three experimental approaches to identify the target genes that are underlying this phenomenon: 1) a microarray analysis of gene expression to identify hormone responsive genes in the cerebellum of Pax8–/– mice, a transgenic mouse model of congenital hypothyroidism; 2) a similar microarray analysis on primary culture of cerebellum neurons; and 3) a bioinformatics screen of conserved putative-binding sites in the mouse genome. This identifies surprisingly a small set of target genes, which, for some of them, might be key regulators of cerebellum development and neuronal differentiation.


    Introduction
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
Thyroid hormones (THs, i.e. 3,5,3'-tri-iodothyronine; T3, and its less active precursor thyroxine (T4)) are essential regulators of brain development, congenital hypothyroidism resulting in severe and irreversible mental retardation (Zoeller & Rovet 2004). Understanding TH action during brain development would bring new insight to our knowledge of basic neurodevelopment mechanisms, help clinical investigations of TH-deficiency consequences and also allow us to address the growing concern that some chemicals present in food are dangerous for brain development (Zoeller & Rovet 2004). Although less common, TH excess is also detrimental to brain development (Kempers et al. 2003, 2005). Rodent cerebellum development is highly sensitive to hypothyroidism and appears to be a suitable experimental model to study congenital hypothyroidism (Lauder 1977, Bernal et al. 2003, Bernal 2005). It takes place mainly during the first post-natal weeks, a developmental stage which coincides with a peak in the circulating level of T3 (Hadj-Sahraoui et al. 2000). At this time, neuroblasts proliferate in the cerebellar external granular layer (EGL), a transient structure that disappears in mice 3 weeks after birth. The EGL cells are capable of self-renewal or migration toward the inner granular layer, where they undergo terminal differentiation. Hypothyroidism results in delayed proliferation, reduced migration, and increased rate of apoptosis of EGL cells, concomitant to a reduction in Purkinje cells arborization. It is also responsible for delayed oligodendrocytes differentiation (Rodriguez-Pena 1999) and aberrant maturation of Bergmann processes of the Golgi epithelial cells, a cerebellum-specific astrocyte population (Morte et al. 2004). In vitro experiments suggest that T3 acts in a cell autonomous manner on all these cell types (Thompson 1996, Trentin et al. 1998, Tang et al. 2000, Kimura-Kuroda et al. 2002, Heuer & Mason 2003). As multiple cell–cell interactions underlie cerebellum development, T3 also acts indirectly (Gomes et al. 1999, Martinez & Gomes 2005).

T3 directly activates gene expression by binding to TH receptors (TRs) expressed from the two THRA and THRB genes (Yen 2001, Flamant et al. 2007). TRs act mainly as heterodimers with retinoid X receptors (RXR), and remain bound to DNA in the absence of hormone binding. Well-characterized T3 response elements (TRE) usually associate two half sites, related to the consensus 5'AGGTCA3', arranged as a direct repeat separated by four nucleotides (DR4), as an everted repeat separated by six nucleotides (ER6) or as a palindrome (IR0; Desvergne 1994). Whereas THRA expression is ubiquitous in cerebellum, THRB is expressed only in Purkinje cells. Unliganded TR{alpha}1, the receptor isotype encoded by THRA, exerts a negative influence on gene expression and is responsible for most of cellular alterations linked to hypothyroidism in cerebellar neurons (Morte et al. 2002). This explains why mice lacking THRA or both THRA and THRB genes (Gothe et al. 1999, Gauthier et al. 2001) do not display the typical features of congenital hypothyroidism in cerebellum neurons (unpublished observations). By contrast, THRA deletion is sufficient to delay the differentiation of oligodendrocyte precursor cells (Billon et al. 2002) and astrocytes (Morte et al. 2004).

Although the expression of a number of genes has been shown to change in hypothyroid brain (Poguet et al. 2003, Bernal 2005, Dong et al. 2005), very few direct target genes of T3 are known in brain. To our knowledge, this includes only Hairless (Hr), Sygr1 (Potter et al. 2001), RC3/neurogranin (Guadano-Ferraz et al. 1997, Morte et al. 1997), BTEB (Denver et al. 1999), and Rhes (Vargiu et al. 2001). We combine here various in vivo and in vitro approaches to identify several other genes, which are regulated by T3 in post-natal cerebellum.


    Material and methods
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
Animals

Pax8–/– knockout mice (Mansouri et al. 1998), which usually die within 3 weeks after birth, were produced from heterozygous parents with a mixed C57Bl6/129Sv genetic background. Wild-type littermates were used as control. TH treatments were performed by two i.p. injections daily (Hegg et al. 1990) performed 48 and 24 h previous killing (0.2 µg T3, 2 µg T4 (Sigma) per gram of body-weight in 100 µl phosphate buffer saline). All animal experimentations were performed under animal care procedures were conducted in accordance with the guidelines set by the European Community Council Directives (86/609/EEC).

Primary neuron cultures

All media were purchased from Invitrogen. Cerebellums were dissected from P2–P4 wild-type mice in Hank’s balanced sodium salt (HBSS, without Ca2+ and Mg2+. Supplemented with 1 mM NaPyruvate and 10 mM HEPES pH 7.4) rinsed in HBSS/Pyruvate/HEPES and resuspended in serum-free culture medium (neurobasal supplemented with B27 (2%) Glutamine (0.5 mM), penicillin (10 U/ml) and streptomycin (10 U/ml)), before seeding on poly-L-lysine (Sigma) coated 24-well multiwells (Falcon; 3x105 cells/cm2). Whenever indicated, cycloheximide (Sigma) was added for 6 h, together with T3 or not, to the culture medium at 100 µg/ml. T3 (Sigma) was used at 10–7 M.

RNA extraction

RNAs were extracted from cerebellum using the mammalian Genelute extraction kit (Sigma) and further purified after RNase-free/DNaseI treatment (Fermentas). RNAs were extracted from primary neuron cultures using the Nanoprep kit, also including DNaseI treatment (Stratagene, San Diego, CA, USA).

Microarray analysis

RNAs were prepared for individual cerebellum either at P8 (three wild-type mice, four Pax8–/– mice, one Pax8–/– mouse treated with TH for 6 h, two Pax8–/– mice treated with TH for 48 h) or P15 (four wild-type mice, three Pax8–/– mice, one Pax8–/– mice treated with TH for 6 h, three Pax8–/– mice treated with TH for 48 h). Each individual RNA was compared with a pool of reference whole brain P15 (10 brains). Twenty-one microarrays were hybridized to amino-allyled, oli-godTV primed, cDNA, prepared from 10 µg of these individual RNA and cross-linked to Cy3 or Cy5 dyes (Amersham). Microarrays for cerebellum RNA analysis were produced at NHGRI and contained 14 000 spotted PCR products, prepared from a non-redundant cDNA library (http://research.nhgri.nih.gov/microarray/downloadable_cdna.shtml). Image analysis was performed using the ArraySuite software package developed at NHGRI, and data with a quality, as defined in ArraySuite, inferior to 1 were discarded, leaving 12 800 spots analyzable in all microarrays. RNA (200 ng) prepared from cultured neurons was first submitted to two rounds of linear amplification (MessageAmp aRNA Amplification Kit, Ambion) before analysis with microarrays spotted with 26 000 synthetic 50-mers oligonucleotides at Reseau National des Génopoles (http://www.micro-array.fr). Two independent experiments were performed. Image analysis was performed using GenePix Pro 6.0 (Molecular Devices, Philadelphia, PA, USA). All data were filtered for low signal and the threshold for TH induction was set to 2.

Quantitative reverse transcription-PCR analysis (Q-RT-PCR)

cDNA were prepared from 100 ng (for cultured neurons) or 1 µg (for cerebellum) RNA using AMV reverse transcriptase (Promega) and random 6-mers primers from an independent set of animals. After 1/50 to 1/100 dilution, 5 µl cDNA were used for quantitative PCR, using either sybrgreen (Invitrogen) or Taqman assay-on-demand assays (Applied Biosystems, Foster City, CA, USA) on a Opticon3 thermocycler (MJ Research). Calibration was performed by 28S RNA, and quantitation was performed in duplicates or triplicates using the HPRT and TBP housekeeping genes as internal standards and the 2{Delta}{Delta}Ct method for analysis (Livak & Schmittgen 2001).

Bioinformatics scanning of putative TH response elements

TRE matching exactly the consensus sequences (5'-(A/G)G(G/T)TCA(N)4(A/G)G(G/T)TCA-3' for DR4, 5'-(A/G)G(G/T)TCATGA(C/A)C(C/T)-3' for IR0, 5'-TGA(C/A)C(C/T)(N)6(A/G)G(G/T)TCA-3' for ER6) and located within 25 kb of annotated cap site were listed for the human and mouse genomes as described (Bourdeau et al. 2004). Hr genomic sequences were scanned with NUBISCAN (Podvinec et al. 2002) using a threshold of P=0.05.

In vitro DNA–protein interaction

A gel retardation assay was used to address the ability of TR{alpha}/RXR{alpha} heterodimers to bind double-stranded 25–28 oligomers centered on consensus TRE sequence. Recombinant human TR{alpha} and RXR{alpha} were prepared from pSG5TR{alpha} and pSG5RXR{alpha} plasmids by coupled in vitro transcription/translation (TnT Coupled Reticulocyte Lysate Systems, Promega). TRE DNA probes were labeled with [{gamma}-32P]ATP using T4 polynucleotide kinase and then purified by acrylamide gel electrophoresis. DNA probe (2x104 c.p.m.) and 2 µl of programed lysate were incubated for 30 min at room temperature in 20 mM Tris (pH 8), 50 mM KCl, 10% glycerol, 50 mM NaCl, 2 mM MgCl2, 2 mM dithiothreitol, 50 ng/µl poly(dI-dC)–poly(dI-dC) and 5 ng/µl salmon sperm DNA. Bound complexes were separated by low ionic strength acrylamide gel electrophoresis (0.5xTris Borate EDTA buffer, 180 V for 90 min). Gels were fixed in a 10% acetic acid/20% methanol solution and dried for autoradiography. For competition experiments, a 100-fold molar excess of unlabeled double-stranded consensus DR4 oligonucleotide (5'CGATTTGAGGTCACAGGAGGTCACACAGT T3') or aspecific oligonucleotide (5'GAGAGGAGATAAG-CTGCCGCTAATGGCCGGGAAA3') were incubated with proteins prior to the addition of labeled double-stranded probe.

Chromatin immunoprecipitation (ChIP) assays

Cerebella from six 20-day-old C57BL/6 animals were pooled and fixed in 1% formaldehyde for 15 min at RT and this was followed by another incubation for 1 h at 4 °C. Cross-linking was stopped by addition of glycine to a final concentration of 0.125 M. ChIP experiments with antibodies raised against TR{alpha}1 (Plateroti et al. 2001) were next performed as previously described (Compe et al. 2005). Coimmunoprecipitated DNA was quantified by real-time quantitative PCR with Lightcycler apparatus (Roche Diagnostic). The primers, whose sequences are available upon request, were designed in order to encompass the thyroid response elements found within the different promoters. The results are presented as percentages of immunoprecipitated DNA relative to the input from two independent experiments. We verified using several negative control fragments, chosen on non-regulated genes, that background PCR amplification corresponds to <0.1% of input DNA.


    Results
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
Microarray analysis

Pax8–/– knockout mice suffer from congenital hypothyroidism due to thyroid agenesis (Mansouri et al. 1998, Flamant et al. 2002). We harvested Pax8–/– cerebellum RNA at post-natal day 8 (P8) or day 15 (P15) either 6 or 48 h after TH treatment. When a stringent twofold change threshold was used, very limited changes in gene expression, both positive and negative, were observed after TH treatment (Table 1Go). With the exception of A kinase (PRKA) anchor protein 1 (Akap1), all genes responded to TH treatment only at one developmental stage. Several genes, present on the microarrays, but absent in Table 1Go, are known to be sensitive to TH treatment. This included BTEB and cyclinD2 for which induction rate were close to the twofold threshold. We thus suspected that the statistical thresholds chosen for microarray analysis were too stringent to identify some authentic TH target genes. However, subsequent Q-RT-PCR experiments showed that, under this threshold, the rate of false positive was high (data not shown).


View this table:
[in this window]
[in a new window]

 
Table 1 Microarray analysis of thyroid hormone response in whole cerebellum
 
To favor the detection of direct T3 target genes and avoid that TH metabolism and transport might oppose to a rapid variation in cerebellum TH content (Galton 2005), we performed another microarray analysis on primary neuron culture RNA. We compared untreated and T3 treated neurons (10–7 M, 6 h), in the presence of cycloheximide, a translation inhibitor, which avoids the activation of secondary target genes. This experiment identified a distinct, and larger set of genes, which were either activated or repressed by T3 treatment (Table 2Go).


View this table:
[in this window]
[in a new window]

 
Table 2 Microarray analysis of 3,5,3'-tri-iodothyronine (T3)-mediated gene activation in cultured cerebellum neurons
 
Q-RT-PCR analysis of gene expression in whole cerebellum

We performed Q-RT-PCR analysis to confirm the regulation both in vivo and in cultured neurons, for candidate T3 target genes (Akap1, kin of IRRE like 3 (Kirrel3), leucine rich repeat protein 1 (Lrrn1), transglutaminase 1 (Tgm1)) and a gene which was close to the twofold threshold in several experiments (Gabra6 ((GABA-A) receptor, subunit {alpha}6) and D0H4S114/P311; Fig. 1Go). We also included control genes whose expression is known to be sensitive to TH deficiency. This last category included Hr, an authentic TH target gene expressed in granular neurons, neurotrophin-3 (NT-3), which is indirectly regulated by TH (Poguet et al. 2003) and PDGFR{alpha}, a marker of oligodendrocytes precursor cells (Tekki-Kessaris et al. 2001) which differentiation is strictly dependent on T3 (Tang et al. 2001) and Pcp2, a gene whose expression in Purkinje cells is known to be reduced in case of hypothyroidism. Hr, Akap1, Gabra6, Kirrel3, Lrrn1, Pcp2 and NT-3 were all activated at P8 when TH treatment was performed in vivo, while PDGFR{alpha} was down-regulated, also not in a significant manner (Fig. 1Go). D0H4S114/P311 expression was not changed (data not shown). The regulation was also addressed for some genes at P15, and the induction rate was generally found to be reduced (data not shown).


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
Figure 1 Q-RT-PCR analysis of whole cerebellum RNA. RNAs were prepared from cerebellum at P8 from hypothyroid Pax8–/– mice (n=8), Pax8–/– treated for 2 days with TH (n=10), or wild-type littermates (n=12). *Indicates mean values which significantly differ from Pax8–/– mean value (Student t-test; P<0.05). Data are expressed as ratios compared with a reference sample (euthyroid whole brain at P15, except for Lrrn1, Kirrel3 and Tgm1 where a T3 treated P8 cerebellum was used, as expression was too low in the reference sample).

 
Q-RT-PCR analysis of gene expression in primary neuronal cell cultures

Three modes of in vivo regulation by TH can be proposed. First, liganded TR can exert direct transcriptional regulation on gene promoter. Alternatively, TH can first activate transcription factors or cofactors regulation, which in turn activate secondary targets in a cell autonomous manner. Finally, non-cell autonomous activation might occur, resulting from the activated secretion of neurotrophic factors, like NT-3, by TH. To distinguish between these possibilities, we performed Q-RT-PCR analysis of gene expression in primary cultures of cerebellar neurons, exposed to T3 (Fig. 2Go). We verified that serum-free culture conditions favor the survival of neurons, mainly granular neurons, at the expense of glial cells. After 48 h of culture, more that 90% of the cells displayed the Tuj1 neuronal marker, whereas less that 2% expressed the Glial fibrillary acidic protein, a marker for astrocytes (data not shown). When treated with T3, these cell cultures quickly reacted (Fig. 2Go) by a robust increase in Hr expression. The response amplitude appeared to be less variable that the in vivo response. By contrast, NT-3 was not activated in this system, confirming the previous conclusion that the in vivo activation of this gene by TH is not a cell autonomous process (Poguet et al. 2003). A moderate augmentation of Akap1, Gabra6, Kirrel3, Lrrn1 and Pcp2 also occurred, suggesting that T3 is acting in a cell autonomous manner to up-regulate these genes and that this activation does not require previous NT-3 activation. When T3 was added for 6 h in the presence of cycloheximide, a translation inhibitor, Hr, Akap1, Lrrn1 and Kirrel3 activation was maintained indicating that these four genes are probably direct T3 target genes.


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
Figure 2 Q-RT-PCR analysis of cultured neurons RNA. RNAs were prepared from cultured neurons 2 days after seeding. T3 was added 6, 24 or 48 h before. Cycloheximide was added (dark bars) to block RNA translation to identify genes, which are likely to be direct target genes. Only one representative experiment is shown. All presented activations were reproducible in three independent experiments. Data are expressed as ratios, compared with average level.

 
Bioinformatics scanning for thyroid response elements

To determine whether the direct target genes identified in the present study were regulated by binding of TR on consensus TRE (DR4, IR0 and ER6), we performed a bioinformatics screen of the whole mouse genome for the consensus elements located within 25 kb of annotated cap sites. As TRE consensus is frequent, even in random sequences, this method identified a large number of putative T3 target genes (5246 TRE with perfect match). Among the 43 up-regulated genes present in Tables 1Go and 2Go, Akap1, ADP-ribosylation factor 1 (Arf1), ATPase, H+ transporting, lysosomal V0 subunit D1, cadherin 1 (CdhI), cytochrome c oxidase (Cox6c), hemoglobin {alpha}, adult chain 1 (Hba-a1), lysozyme, leucine-rich repeats and calponin homology domain containing 4, Lrrn1, protein phosphatase 2, reg. subunit B, {delta}, Myeloid ecotropic viral integration site-related gene 1 (Mrg1) and Spindlin were found in this list. Although this is an indication that these genes might be direct TR target genes, the observed frequency of TRE-containing genes (12 out of 43 regulated genes) is close to the frequency (30%) expected for a random distribution of TRE elements in the genome. To focus our analysis on the TRE that are more likely to be important for developmental regulation, and thus conserved during evolution, we crossed the list of the equivalent list obtained for the human genome to identify TRE present in both homologous genes. This criterion has been shown to facilitate the recognition of true nuclear hormone target genes (Bourdeau et al. 2004). This allowed us to focus on the subset of 157 putative target genes which possess a perfectly matched TRE in both species (113 DR4, 25 IR0 and 19 ER6). This list included Akap1 and Mrg1.

We also addressed the possibility that the list of genes with a consensus TRE in both the mouse and human genomes contains other TH target genes, which are regulated during cerebellum development, but were not identified in our microarray experiments. We first monitored databases for expression patterns (GENSAT, Genepaint, Allen Brain Atlas) and for published genetic evidence of possible involvement in neurodevelopment and neural cells differentiation. We then selected 19 of these genes for further Q-RT-PCR expression analysis: Adam23, Chrna1, COUP-TFI, Crk, c-ski, Dlgh1, a-laminin, Lin28, Midnolin, Prdx3, Prkca, Ptprj, SEMA4G, Sncb, Stathmin, Syngr, Tle6, Tgm1 and Vav1. Among these, only Tgm1 was found to be highly induced in vivo in cerebellum (Fig. 1Go), but was not expressed in cultured neurons.

Hr, which is directly regulated by T3 and possesses an identified TRE 2345 upstream to its cap site (Thompson & Bottcher 1997), was not present in the list of genes with an evolutionary conserved TRE. This indicates that the choice of a stringent threshold precludes the identification of a fraction of the authentic TH target genes. To scan for response elements more loosely related to the consensus, we used NUBISCAN (P=0.05 threshold) to analyze individual mouse genomic regions covering the candidate TH target genes cap sites. This identified three other putative TRE for Hr (Table 3Go).


View this table:
[in this window]
[in a new window]

 
Table 3 Bioinformatics prediction of thyroid hormone response elements
 
Identification of TR{alpha}/RXR{alpha} heterodimers bound to TRE in vitro and in vivo

To ascertain that we have identified bona fide direct TR{alpha}1 target genes, the only isoform present in all cerebellar cell types, we performed protein–DNA interaction assays on some of the most likely candidate genes. In vitro, TR{alpha}/RXR{alpha} heterodimers were able to bind to the TRE identified (Table 3Go) for Hr (–2345), Akap1, CdhI, Hba-a1 and Tgm1 (Fig. 3Go). We finally used ChIP assays to directly establish the actual occupancy of promoters by TR (Fig. 4Go). In whole cerebellum extracts, TR{alpha} was found to be present on fragments covering the identified TRE for Hr, Akap1, Cdh1, Hba-a1, Mrg1, Tgm1. Taken together, these data strongly suggest that TR{alpha} heterodimers, bound to identified DR4 elements, mediate positive regulation of Hr, Akap1, Hba-a1, Tgm1 and negative regulation of Cdh1 and Mrg1.


Figure 3
View larger version (65K):
[in this window]
[in a new window]

 
Figure 3 In vitro interaction between putative TRE and TR{alpha}/RXR{alpha} heterodimers. A double-stranded DR4 consensus sequence (5' AGGTCAcaggAGGCTA3') was used as positive control and found to form a complex with recombinant TR{alpha}/RXR{alpha}. (2) but not with unprogramed reticulocytes lysate (1). Binding specificity was verified by competition with unlabeled specific (3) or non-specific (4) DNA. Similar complexes, destabilized by competition with excess of consensus DR4 TRE, formed with DR4 found in Hr, Akap1, Cdh1, Tgm1 and Hba-a1.

 

Figure 4
View larger version (8K):
[in this window]
[in a new window]

 
Figure 4 In vivo recruitment of TR{alpha} on identified TRE. The recruitments of TR{alpha}1 on the TRE found in the promoter of Hr, Akap1, Hba-a1, Tgm1, Cdh1 and Mrg1 were analyzed by ChIP assays in cerebella of 20-day-old C57BL/6 mice. Specific immunoprecipitated DNA was quantified by real-time quantitative PCR. The results are presented as percentages of immunoprecipitated DNA relative to the input, after background subtraction.

 

    Discussion
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
In the present study, we combined bioinformatics prediction, primary neuronal culture and whole cerebellum RNA microarray analysis to identify genes, which are regulated by T3 in the developing cerebellum. Previous attempts were either limited to cultured neurons (Martel et al. 2002) comparison between hypothyroid and euthyroid animals (Dong et al. 2005), performed on whole brain RNA only (Poguet et al. 2003) or at a post-developmental stage (Haas et al. 2004). These studies identified few putative TH target genes suggesting that, upon TH treatment, the expression of a limited number of genes is changed and the induction rates are limited. The numerous differences observed between hypothyroid and euthyroid animals (Dong et al. 2005) might thus mainly reflect a difference in cell composition. This contrasts with the situation found in liver (Flores-Morales et al. 2002, Yen et al. 2003) or skin fibroblasts (Moeller et al. 2005), where the same experimental approaches revealed that expression of many genes quickly changes after T3 treatment. Although technical limitations might have hampered the identification of the entire repertoire of TH target genes in cerebellum, the present study strongly suggests that the actual number of direct transcriptional TH targets is much more limited than in other tissues. It seems therefore that gene regulation by TH in the developing cerebellum has to be tightly controlled. This also suggests that studying T3 action will help to pinpoint few target genes involved in the basic molecular mechanisms underlying cell proliferation, differentiation, migration, and apoptosis in brain and bring a new insight into the genetic program which controls brain development.

Parts of the TH-induced changes in gene expression that we have observed are indirectly related to TH function, and only reflect the advancement of cerebellum maturation and cellular differentiation. PDGFR{alpha} for example is a specific marker for oligodendrocyte precursor cells in brain. The decrease of PDGFR{alpha} during post-natal development, its increased expression in hypothyroid mice or its slight decrease after TH in vivo treatment probably reflects only oligodendrocytes precursor differentiation. Gabra6 is expressed only in inner granular cells and its up-regulation by TH might also reflect progression of this cell type toward terminal differentiation. However, although it is not a direct TR target gene, Gabra6 is activated by TH in cultured neurons, most probably in a cell autonomous manner. This gene encodes a cerebellum-specific subunit of GABA receptors whose specific function has not been clarified by knockout analysis (Jones et al. 1997). As GABA is believed to exert, beside its neurotransmitter function, a trophic effect during brain development (Owens & Kriegstein 2002), it would be interesting to explore the possible implication of Gabra6 in this poorly understood process and its putative regulation by TH. Some other indirect TH-mediated gene regulation might explain some features of hypo- or hyper-thyroidism. Sema3d encodes a semaphorin expressed at high level in cerebellum granular cells (according to the GENSAT database), which might be important for EGL cells migration. Syt4 encodes Synaptotagmin IV a secretory vesicle protein thought to function as an inhibitor of neurotransmitter release, and as a neuroprotective factor (Ferguson et al. 2004). This view has been recently challenged (Ting et al. 2006) in favor of an alternative hypothesis stating that Synaptotagmin IV regulates glial glutamate release (Zhang et al. 2004). Itpr1, also called Pcp1, is enriched in Purkinje cells, where it has a crucial role for Ca2+ signaling (Matsumoto & Kato 2001).

By combining expression and protein–DNA interaction analysis, we accumulated enough evidence to ascertain that T3 directly up-regulates in the cerebellum the expression of the following six genes: Akap1, Cdh1, Hba-a1, Hr, Mrg1, Tgm1. Only Hr was already known to be a TH target gene. In vitro neuronal cultures also suggests that Lrrn1 and Kirrel3 belong to this category of direct TH targets, although we did not identify evolutionary conserved TRE for these two genes. Three of these genes (Cdh1, Mrg1, Akap1) were identified by whole cerebellum microarray analysis, three (Lrrn1, Kirrel3, Hba-a1) by microarray analysis of cultured neurons, and the last gene (Tgm1) was found by bioinformatics screening. Interestingly, T3 seems to directly mediate both positive (Akap1, Hba-a1, Hr, Kirrel3, Lrrn1, Tgm1) and negative (Cdh1, Mrg1) transcriptional regulation. This reinforces the view that the current model for TR-mediated transcription (Rosenfeld et al. 2006) is still incomplete (Nygard et al. 2003, 2006). The expression of Akap1, Kirrel3, Lrrn1, and Tgm1 was not significantly reduced in hypothyroid Pax8–/– mice when compared with wild type. These genes thus seem to belong to a distinct category of T3-regulated genes that are mainly regulated by supra-physiological levels of T3 (Yen et al. 2003). Such a regulation might thus be more relevant to the developmental alterations resulting from hyperthyroidism, rather than hypothyroidism.

Lrrn1 function is unknown. It encodes a neuronal protein with an IgCAM domain which might indicate an intervention in neuronal migration. The poorly studied Kirrel3 gene encodes a nephrin-like trans-membrane protein involved in homophilic adhesion (Serizawa et al. 2006) able to support stem cells proliferation (Ueno et al. 2003). Its expression pattern also suggests a function in late differentiation processes, especially synapses formation (Tamura et al. 2005). Tgm1 encodes a Tgm1 with an important function in skin (Matsuki et al. 1998). Its expression pattern and function in brain are unknown. Hba-a1, only known function, is to encode the ‘a’ subunit of hemoglobin and its expression in cerebellum is surprising at first glance. However, it has been shown that Hbb-b, which encodes the other subunit of hemoglobin, is present in cultured oligodendrocyte precursor cells, and down-regulated when their differentiation is triggered by NT-3 withdrawal and TH addition (Dugas et al. 2006). Therefore, hemoglobin might exist in non-erythroid cells and fulfill alternative function. Akap1 encodes an anchoring protein widely expressed in brain (McKee et al. 2005) and crucial for cAMP/PKA signaling (Newhall et al. 2006), a pathway which mediates the anti-apoptotic activity of IGF1 on cerebellum granular neurons (Subramaniam et al. 2005). The down-regulation of cdh1, encoding E-cadherin, should also influence granular cell cycling and differentiation (Almeida et al. 2005).

Together with the previously identified other T3 target genes (Sygr1, RC3/neurogranin, BTEB, and Rhes), the new set of genes that we have identified offer interesting new entry points to the genetic program which control the complex network of cell–cell interactions that coordinate the normal post-natal development of cerebellum.


    Acknowledgements
 
We thank Jean-Marc Egly for his kind support, Nadine Aguilera and the PBES staff for mouse breeding and Aurélie Laugraud for statistical analysis. This work was supported by French Ministery of Research (ACI Biologie Cellulaire, Moléculaire et Structurale) Ligue contre le Cancer (équipe labellisée) the CASCADE European Network of Excellence (EU contract no. FOOD-CT-2004-506319) the CRESCENDO EU integrated project. E C was supported by Agence Nationale de la Recherche (ANR-06-BLAN-0141-01) and Association pour la Recherche contre le Cancer (A06-2-3153). L Q was supported by the Fondation pour la Recherche Médicale. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
Almeida A, Bolanos JP & Moreno S 2005 Cdh1/Hct1-APC is essential for the survival of postmitotic neurons. Journal of Neuroscience 25 8115–8121.[Abstract/Free Full Text]

Bernal J 2005 Thyroid hormones and brain development. Vitamins and Hormones 71 95–122.[CrossRef][Web of Science][Medline]

Bernal J, Guadano-Ferraz A & Morte B 2003 Perspectives in the study of thyroid hormone action on brain development and function. Thyroid 13 1005–1012.[CrossRef][Web of Science][Medline]

Billon N, Jolicoeur C, Tokumoto Y, Vennstrom B & Raff M 2002 Normal timing of oligodendrocyte development depends on thyroid hormone receptor alpha 1 (TR{alpha}1). EMBO Journal 21 6452–6460.[CrossRef][Web of Science][Medline]

Bourdeau V, Deschenes J, Metivier R, Nagai Y, Nguyen D, Bretschneider N, Gannon F, White JH & Mader S 2004 Genome-wide identification of high-affinity estrogen response elements in human and mouse. Molecular Endocrinology 18 1411–1427.[Abstract/Free Full Text]

Compe E, Drane P, Laurent C, Diderich K, Braun C, Hoeijmakers JH & Egly JM 2005 Dysregulation of the peroxisome proliferator-activated receptor target genes by XPD mutations. Molecular and Cellular Biology 25 6065–6076.[Abstract/Free Full Text]

Denver RJ, Ouellet L, Furling D, Kobayashi A, Fujii-Kuriyama Y & Puymirat J 1999 Basic transcription element-binding protein (BTEB) is a thyroid hormone-regulated gene in the developing central nervous system. Evidence for a role in neurite outgrowth. Journal of Biological Chemistry 274 23128–23134.[Abstract/Free Full Text]

Desvergne B 1994 How do thyroid hormone receptors bind to structurally diverse response elements? Molecular and Cellular Endocrinology 100 125–131.[CrossRef][Web of Science][Medline]

Dong H, Wade M, Williams A, Lee A, Douglas GR & Yauk C 2005 Molecular insight into the effects of hypothyroidism on the developing cerebellum. Biochemical and Biophysical Research Communications 330 1182–1193.[CrossRef][Web of Science][Medline]

Dugas J, YC T, Speed TP, Ngai J & Barres B 2006 Functional genomic analysis of oligodendrocyte differentiation. Journal of Neuroscience 26 10967–10983.[Abstract/Free Full Text]

Ferguson GD, Wang H, Herschman HR & Storm DR 2004 Altered hippocampal short-term plasticity and associative memory in synaptotagmin IV (–/–) mice. Hippocampus 14 964–974.[CrossRef][Web of Science][Medline]

Flamant F, Poguet AL, Plateroti M, Chassande O, Gauthier K, Streichenberger N, Mansouri A & Samarut J 2002 Congenital hypothyroid Pax8(–/–) mutant mice can be rescued by inactivating the TR{alpha} gene. Molecular Endocrinology 16 24–32.[Abstract/Free Full Text]

Flamant F, Gauthier K & Samarut J 2007 Thyroid hormones signaling is getting more complex: STORMs are coming. Molecular Endocrinology 21 321–333.[Abstract/Free Full Text]

Flores-Morales A, Gullberg H, Fernandez L, Stahlberg N, Lee NH, Vennstrom B & Norstedt G 2002 Patterns of liver gene expression governed by TRß. Molecular Endocrinology 16 1257–1268.[Abstract/Free Full Text]

Galton VA 2005 The roles of the iodothyronine deiodinases in mammalian development. Thyroid 15 823–834.[CrossRef][Web of Science][Medline]

Gauthier K, Plateroti M, Harvey CB, Williams GR, Weiss RE, Refetoff S, Willott JF, Sundin V, Roux JP, Malaval L et al. 2001 Genetic analysis reveals different functions for the products of the thyroid hormone receptor alpha locus. Molecular and Cellular Biology 21 4748–4760.[Abstract/Free Full Text]

Gomes FC, Maia CG, de Menezes JR & Neto VM 1999 Cerebellar astrocytes treated by thyroid hormone modulate neuronal proliferation. Glia 25 247–255.[CrossRef][Web of Science][Medline]

Gothe S, Wang Z, Ng L, Kindblom JM, Barros AC, Ohlsson C, Vennstrom B & Forrest D 1999 Mice devoid of all known thyroid hormone receptors are viable but exhibit disorders of the pituitary–thyroid axis, growth, and bone maturation. Genes and Development 13 1329–1341.[Abstract/Free Full Text]

Guadano-Ferraz A, Escamez MJ, Morte B, Vargiu P & Bernal J 1997 Transcriptional induction of RC3/neurogranin by thyroid hormone: differential neuronal sensitivity is not correlated with thyroid hormone receptor distribution in the brain. Brain Research. Molecular Brain Research 49 37–44.[Medline]

Haas MJ, Mreyoud A, Fishman M & Mooradian AD 2004 Microarray analysis of thyroid hormone-induced changes in mRNA expression in the adult rat brain. Neuroscience Letters 365 14–18.[CrossRef][Web of Science][Medline]

Hadj-Sahraoui N, Seugnet I, Ghorbel MT & Demeneix B 2000 Hypothyroidism prolongs mitotic activity in the post-natal mouse brain. Neuroscience Letters 280 79–82.[CrossRef][Web of Science][Medline]

Hegg E, Li S, Faure M & Ver O 1990 Keystone Symposia, Nuclear Hormone receptors Taos, NM, USA (abstract).

Heuer H & Mason CA 2003 Thyroid hormone induces cerebellar Purkinje cell dendritic development via the thyroid hormone receptor alpha1. Journal of Neuroscience 23 10604–10612.[Abstract/Free Full Text]

Jones A, Korpi ER, McKernan RM, Pelz R, Nusser Z, Makela R, Mellor JR, Pollard S, Bahn S, Stephenson FA et al. 1997 Ligand-gated ion channel subunit partnerships: GABAA receptor {alpha}6 subunit gene inactivation inhibits delta subunit expression. Journal of Neuroscience 17 1350–1362.[Abstract/Free Full Text]

Kempers MJ, van Tijn DA, van Trotsenburg AS, de Vijlder JJ, Wiedijk BM & Vulsma T 2003 Central congenital hypothyroidism due to gestational hyperthyroidism: detection where prevention failed. Journal of Clinical Endocrinology and Metabolism 88 5851–5857.[Abstract/Free Full Text]

Kempers MJ, van Trotsenburg AS, van Tijn DA, Bakker E, Wiedijk BM, Endert E, de Vijlder JJ & Vulsma T 2005 Disturbance of the fetal thyroid hormone state has long-term consequences for treatment of thyroidal and central congenital hypothyroidism. Journal of Clinical Endocrinology and Metabolism 90 4094–4100.[Abstract/Free Full Text]

Kimura-Kuroda J, Nagata I, Negishi-Kato M & Kuroda Y 2002 Thyroid hormone-dependent development of mouse cerebellar Purkinje cells in vitro. Brain Research. Developmental Brain Research 137 55–65.[CrossRef][Medline]

Lauder JM 1977 The effects of early hypo- and hyper-thyroidism on the development of rat cerebellar crotex. III. Kinetics of cell proliferation in the external granular layer. Brain Research 126 31–51.[CrossRef][Web of Science][Medline]

Livak JL & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 25 402–408.[CrossRef][Web of Science][Medline]

Mansouri A, Chowdhury K & Gruss P 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nature Genetics 19 87–90.[CrossRef][Web of Science][Medline]

Martel J, Cayrou C & Puymirat J 2002 Identification of new thyroid hormone-regulated genes in rat brain neuronal cultures. Neuroreport 13 1849–1851.[CrossRef][Web of Science][Medline]

Martinez R & Gomes FC 2005 Proliferation of cerebellar neurons induced by astrocytes treated with thyroid hormone is mediated by a cooperation between cell contact and soluble factors and involves the epidermal growth factor-protein kinase a pathway. Journal of Neuroscience Research 80 341–349.[CrossRef][Web of Science][Medline]

Matsuki M, Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al. 1998 Defective stratum corneum and early neonatal death in mice lacking the gene for transglutaminase 1 (keratinocyte transglutaminase). PNAS 95 1044–1049.[Abstract/Free Full Text]

Matsumoto M & Kato K 2001 Altered calcium dynamics in cultured cerebellar cells from IP3R1-deficient mice. Neuroreport 12 3471–3474.[CrossRef][Web of Science][Medline]

McKee AE, Minet E, Stern C, Riahi S, Stiles CD & Silver PA 2005 A genome-wide in situ hybridization map of RNA-binding proteins reveals anatomically restricted expression in the developing mouse brain. BMC Developmental Biology 5 14.[CrossRef][Medline]

Moeller LC, Dumitrescu AM, Walker RL, Meltzer PS & Refetoff S 2005 Thyroid hormone responsive genes in cultured human fibroblasts. Journal of Clinical Endocrinology and Metabolism 90 936–943.[Abstract/Free Full Text]

Morte B, Iniguez MA, Lorenzo PI & Bernal J 1997 Thyroid hormone-regulated expression of RC3/neurogranin in the immortalized hypothalamic cell line GT1-7. Journal of Neurochemistry 69 902–909.[Web of Science][Medline]

Morte B, Manzano J, Scanlan T, Vennstrom B & Bernal J 2002 Deletion of the thyroid hormone receptor {alpha}1 prevents the structural alterations of the cerebellum induced by hypothyroidism. PNAS 99 3985–3989.[Abstract/Free Full Text]

Morte B, Manzano J, Scanlan TS, Vennstrom B & Bernal J 2004 Aberrant maturation of astrocytes in thyroid hormone receptor {alpha}1 knockout mice reveals an interplay between thyroid hormone receptor isoforms. Endocrinology 145 1386–1391.[Abstract/Free Full Text]

Newhall KJ, Criniti AR, Cheah CS, Smith KC, Kafer KE, Burkart AD & McKnight GS 2006 Dynamic anchoring of PKA is essential during oocyte maturation. Current Biology 16 321–327.[CrossRef][Web of Science][Medline]

Nygard M, Wahlstrom GM, Gustafsson MV, Tokumoto YM, Bondesson M, Brooksbank C, Causton HC, Cavalieri D, Gaasterland T, Hingamp P et al. 2003 Hormone-dependent repression of the E2F-1 gene by thyroid hormone receptors. Molecular Endocrinology 17 79–92.[Abstract/Free Full Text]

Nygard M, Becker N, Demeneix B, Pettersson K & Bondesson M 2006 Thyroid hormone-mediated negative transcriptional regulation of Necdin expression. Journal of Molecular Endocrinology 36 517–530.[Abstract/Free Full Text]

Owens DF & Kriegstein AR 2002 Is there more to GABA than synaptic inhibition? Nature Reviews. Neuroscience 3 715–727.[CrossRef][Web of Science][Medline]

Plateroti M, Gauthier K, Domon-Dell C, Freund JN, Samarut J & Chassande O 2001 Functional interference between thyroid hormone receptor {alpha} (TR{alpha}) and natural truncated TR{Delta}{alpha} isoforms in the control of intestine development. Molecular and Cellular Biology 21 4761–4772.[Abstract/Free Full Text]

Podvinec M, Kaufmann MR, Handschin C & Meyer UA 2002 NUBIScan, an in silico approach for prediction of nuclear receptor response elements. Molecular Endocrinology 16 1269–1279.[Abstract/Free Full Text]

Poguet AL, Legrand C, Feng X, Yen PM, Meltzer P, Samarut J & Flamant F 2003 Microarray analysis of knockout mice identifies cyclin D2 as a possible mediator for the action of thyroid hormone during the postnatal development of the cerebellum. Developmental Biology 254 188–199.[CrossRef][Web of Science][Medline]

Potter GB, Beaudoin GM, III., DeRenzo CL, Zarach JM, Chen SH & Thompson CC 2001 The hairless gene mutated in congenital hair loss disorders encodes a novel nuclear receptor corepressor. Genes and Development 15 2687–2701.[Abstract/Free Full Text]

Rodriguez-Pena A 1999 Oligodendrocyte development and thyroid hormone. Journal of Neurobiology 40 497–512.[CrossRef][Web of Science][Medline]

Rosenfeld MG, Lunyak VV & Glass CK 2006 Sensors and signals: a coactivator/corepressor/epigenetic code for integrating signal-dependent programs of transcriptional response. Genes and Development 20 1405–1428.[Abstract/Free Full Text]

Serizawa S, Miyamichi K, Takeuchi H, Yamagishi Y, Suzuki M & Sakano H 2006 A neuronal identity code for the odorant receptor-specific and activity-dependent axon sorting. Cell 127 1057–1069.[CrossRef][Web of Science][Medline]

Subramaniam S, Shahani N, Strelau J, Laliberte C, Brandt R, Kaplan D & Unsicker K 2005 Insulin-like growth factor 1 inhibits extracellular signal-regulated kinase to promote neuronal survival via the phosphatidylinositol 3-kinase/protein kinase A/c-Raf pathway. Journal of Neuroscience 25 2838–2852.[Abstract/Free Full Text]

Tamura S, Morikawa Y, Hisaoka T, Ueno H, Kitamura T & Senba E 2005 Expression of mKirre, a mammalian homolog of Drosophila kirre, in the developing and adult mouse brain. Neuroscience 133 615–624.[CrossRef][Web of Science][Medline]

Tang DG, Tokumoto YM & Raff MC 2000 Long-term culture of purified postnatal oligodendrocyte precursor cells. Evidence for an intrinsic maturation program that plays out over months. Journal of Cell Biology 148 971–984.[Abstract/Free Full Text]

Tang DG, Tokumoto YM, Apperly JA, Lloyd AC & Raff MC 2001 Lack of replicative senescence in cultured rat oligodendrocyte precursor cells. Science 291 868–871.[Abstract/Free Full Text]

Tekki-Kessaris N, Woodruff R, Hall AC, Gaffield W, Kimura S, Stiles CD, Rowitch DH & Richardson WD 2001 Hedgehog-dependent oligodendrocyte lineage specification in the telencephalon. Development 128 2545–2554.[Abstract/Free Full Text]

Thompson CC 1996 Thyroid hormone-responsive genes in developing cerebellum include a novel synaptotagmin and a hairless homolog. Journal of Neuroscience 16 7832–7840.[Abstract/Free Full Text]

Thompson CC & Bottcher MC 1997 The product of a thyroid hormone-responsive gene interacts with thyroid hormone receptor. PNAS 94 8527–8532.[Abstract/Free Full Text]

Ting JT, Kelley BG & Sullivan JM 2006 Synaptotagmin IV does not alter excitatory fast synaptic transmission or fusion pore kinetics in mammalian CNS neurons. Journal of Neuroscience 26 372–380.[Abstract/Free Full Text]

Trentin AG, Gomes FC, Lima FR & Neto VM 1998 Thyroid hormone acting on astrocytes in culture. In Vitro Cellular and Developmental Biology. Animal 34 280–282.[CrossRef]

Ueno H, Sakita-Ishikawa M, Morikawa Y, Nakano T, Kitamura T & Saito M 2003 A stromal cell-derived membrane protein that supports hematopoietic stem cells. Nature Immunology 4 457–463.[CrossRef][Web of Science][Medline]

Vargiu P, Morte B, Manzano J, Perez J, de Abajo R, Gregor Sutcliffe J & Bernal J 2001 Thyroid hormone regulation of rhes, a novel Ras homolog gene expressed in the striatum. Brain Research. Molecular Brain Research 94 1–8.[Medline]

Yen PM 2001 Physiological and molecular basis of thyroid hormone action. Physiological Reviews 81 1097–1142.[Abstract/Free Full Text]

Yen PM, Feng X, Flamant F, Chen Y, Walker RL, Weiss RE, Chassande O, Samarut J, Refetoff S & Meltzer PS 2003 Effects of ligand and thyroid hormone receptor isoforms on hepatic gene expression profiles of thyroid hormone receptor knockout mice. EMBO Reports 4 581–587.[CrossRef][Web of Science][Medline]

Zhang Q, Fukuda M, Van Bockstaele E, Pascual O & Haydon PG 2004 Synaptotagmin IV regulates glial glutamate release. PNAS 101 9441–9446.[Abstract/Free Full Text]

Zoeller RT & Rovet J 2004 Timing of thyroid hormone action in the developing brain: clinical observations and experimental findings. Journal of Neuroendocrinology 16 809–818.[CrossRef][Web of Science][Medline]

Received in final form 16 April 2007
Accepted 28 April 2007
Made available online as an Accepted Preprint 2 May 2007




This article has been cited by other articles:


Home page
EndocrinologyHome page
D. Diez, C. Grijota-Martinez, P. Agretti, G. De Marco, M. Tonacchera, A. Pinchera, G. Morreale de Escobar, J. Bernal, and B. Morte
Thyroid Hormone Action in the Adult Brain: Gene Expression Profiling of the Effects of Single and Multiple Doses of Triiodo-L-Thyronine in the Rat Striatum
Endocrinology, August 1, 2008; 149(8): 3989 - 4000.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quignodon, L.
Right arrow Articles by Flamant, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quignodon, L.
Right arrow Articles by Flamant, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS