|
|
||||||||
Endocrinology Centre, William Harvey Research Institute, Barts and The London, Queen Mary, University of London, London EC1A 7BE, UK
1 Institute of Comparative Medicine, University of Glasgow Veterinary School, Glasgow G61 1QH, UK
(Requests for offprints should be addressed to P J King who is now at Molecular Endocrinology Centre, William Harvey Research Institute, John Vane Science Building, Charterhouse Square, London EC1M 6BQ, UK; Email: p.j.king{at}qmul.ac.uk)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
(PPAR
) and transcription of the MC2-R gene is induced within 24 h treatment of 3T3-L1 cells with adipogenic agents (Noon et al. 2004). It has also been shown that there is detectable MC2-R expression in murine foetal testes and ACTH is able to stimulate testosterone production in this tissue (OShaughnessy et al. 2003). Testicular expression declines markedly after birth in the mouse and is barely detectable in the adult. Other reported sites of extra-adrenal expression, include human skin (Slominski et al. 1996), sympathetic ganglia (Nankova et al. 2003), the pituitary (Morris et al. 2003), bone marrow (Gondo et al. 2004), osteoblasts and osteoclasts (Zhong et al. 2005). The murine MC2-R gene (mMC2-R) is located on chromosome 18 (Cammas et al. 1995, Kubo et al. 1995). The entire coding region of the murine MC2-R was reported to be contained within a single exon with two untranslated exons 5' to it (Cammas et al. 1997). Subsequently, a fourth exon was identified, which was alternately spliced in between the two previously described 5' exons in a minority of adrenal transcripts (Shimizu et al. 1997). These exons are referred to as exons 14, with exon 4 containing the coding sequence. Alternative splicing within the 5' untranslated region (5' UTR) has also been reported for the human gene (Kubo et al. 2000).
In this study, we report the expression of novel mMC2-R transcripts containing a previously unidentified exon in the 5' UTR included in transcripts from both the 5' promoter and also the recently identified adipocyte-specific promoter (Kubo et al. 2004). This exon is more highly expressed in the murine adrenal gland and adipose tissue than adrenocortical Y1 cells and murine foetal testes data indicate the complexity of tissue-specific alternative promoter usage and post-transcriptional processing.
| Materials and methods |
|---|
|
|
|---|
Normal mice, derived from F1 hybrids of C3H/HeH and 101/H strains, were bred as described previously (OShaughnessy et al. 2003). To time foetal development, males were caged with females overnight and the morning was designated as embryonic day (E) 0.5. Tissues were recovered from adult animals and from foetuses at E17.5 and stored in liquid N2.
Cell culture
3T3-L1 pre-adipocytes (American type culture collection) were maintained in Dulbeccos modified Eagle medium (DMEM), 10% foetal bovine serum (Life Technologies) at 37 °C with 5% CO2 and differentiated by treating 2 day post-confluent cells (day 0) with media containing 0.5 mM 3-isobutyl-1-methyl-xanthine, 0.25 µM dexamethasone and 1 µg/ml insulin for 2 days. On day 2 media was replaced with insulin only containing media (1 µg/ml). Y1 cells were grown in a 1:1 mixture of DMEM:Hams F10 supplemented with 12.5% horse serum and 2.5% foetal bovine serum (all from Life Technologies).
Reverse transcriptase (RT) PCR
Cytoplasmic RNA was harvested from 3T3-L1 cells grown in 6-well plates using the RNeasy miniprep kit (Qiagen) according to the manufacturers guidelines. Two microgram RNA was then treated at 37 °C for 15 min prior to reverse transcription (RT). The RT reactions were performed at 37 °C for 1 h using Moloney murine leukaemia virus-RT and random hexamers (Promega). RNA was extracted from mouse tissues using Trizol (Life Technologies) and reverse transcribed as PCRs were performed using the cDNA equivalent of 50 ng cytoplasmic RNA. The PCR products were then subjected to agarose gel electrophoresis. The following primer sequences (SigmaGenosys) were used (Forward:Reverse); MC2-R (CTTGCCGAGAAAGATCCT (exon 1):GGATCTGGCTTAGAAGGG (exon 4/5)), upper (CCACTCATCAGTTGATGG (exon 3)):GGATCTGGCTTAGAAGGG glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (TGCACCACCAACTGCTTAG:GGATGCAGGGATGATGTTC). All RT-PCR experiments were performed at least with equivalent results. Representative experiments are shown.
Quantitative (Q) RT PCR
Q-PCR was performed using SYBR green (Molecular Probes, Eugene, Oregon, USA) and an MX4000 real-time PCR machine (Stratagene, Amsterdam, Netherlands). SYBR green fluorescence was quantified using a serial dilution of template-containing plasmid or PCR product of known concentration and relative abundance of transcript was normalised against 18S RNA levels (primers from Eurogentec). The following primer sequences (SigmaGenosys) were used (Forward:Reverse); MC2-R lower (GAGCTGAAGCCAGCAAGC (exon 1/4): GGATCTGGCTTAGAAGGG), middle (TACCCTCAACCAGCAAGC (exon 2/4):GGATCTGGCTTAGAAGGG), upper (CCACTCATCAGTTGATGG (exon 3):GGATCTGGCTTAGAAGGG), lipoprotein lipase (CAACATTGGAGAAGCCATCC:CTACAACTCAGGCAGAGCCC), ALBP (GATCATCAGCGTAAATGGGG:TTGTGGTCGACTTTCCATCC) PPAR
2 (GAGATTCTCCTGTTGACCC:A GCTTCAATCGGATGGTTC).
Sequencing
PCR products were excised from agarose gels and the DNA was purified using a Qiagen gel extraction kit. PCR products were then sequenced in both directions using the MC2-R forward and reverse primers with the ABI Prism dye terminator DNA sequencing kit. Sequencing reactions were run on an ABI Prism 377 sequencer. The resulting sequences were analysed using a basic local alignment search tool (BLAST) search of the Genbank database to identify and locate the sequences in the mouse genome.
| Results |
|---|
|
|
|---|
2. These data once again confirm that the upregulation of MC2-R mRNA expression, particularly as judged by the expression of exon 1-specific transcripts, is a rapid event following the induction of differentiation.
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
The delayed upregulation of the novel transcript with respect to the other two species may suggest that its expression is regulated in a different manner to the two previously reported transcripts. This observation is supported by the apparent relative abundance of the novel transcript in both brown and white adipose tissues. It also seems that while the novel transcript is readily detectable in the foetal murine adrenal gland it is barely expressed in the foetal testis, despite the clear presence of both of the previously identified transcripts in these tissues. Indeed, this study is the first to demonstrate the pattern of MC2-R splicing in the foetal testis, which has a shared embryological origin to the cells of the adrenal cortex in the adrenogenital primordium (Hatano et al. 1996). The novel exon may therefore be useful as a marker for distinguishing adrenal progenitors expressing this sequence from those that develop into the foetal testis.
We have demonstrated the relative kinetics of induction of the three splice products and noted that the lower transcript, including exon 1, is rapidly but transiently upregulated. We have shown (Noon et al. 2007) that there is a switch in promoter usage around day 6 from the upstream promoter to a novel CCAAT/enhancer binding protein (C/EBP)-driven downstream promoter, which accounts for both the decline in exon 1-specific mRNA synthesis and the continued MC2-R expression and mRNA synthesis, as observed in the exons 2- and 3-specific Q-PCR figures. The abundant transcription from the novel promoter in adipocytes can be seen in Fig. 4
.
The 5' UTR of the majority of mammalian genes is short and free of uORFs (reviewed in Morris & Geballe 2000, Meijer & Thomas 2002). Exon 3 increases the length of the 5' UTR to 468 nt with exon 1 and 500 nt with exon 1* and contains three uAUGs, with the longest uORF potentially encoding a 53 amino acid peptide. All of the uORFs are terminated before the initiating methionine of the MC2-R and therefore do not alter the coding sequence of the receptor. An increasing number of genes is being discovered with uORFs, most often those with important roles in cell growth and differentiation (Morris & Geballe 2000). In most cases studied it appears that these uORFs have a negative control on translatability of mRNA, often by blocking the scanning of ribosomes (Reynolds et al. 1996, Morris & Geballe 2000, Meijer & Thomas 2002), although it has been shown that two uORFs in the retinoic acid receptor ß2 isoform (RARß2) are important for efficient translation of the mRNA (Reynolds et al. 1996). The inclusion of exon 3 could potentially allow the MC2-R to bypass the inhibition of translation observed in terminally differentiated cells (Gerlitz et al. 2002) and the relative abundance of transcripts including exon 3 during adipogenesis may therefore be significant in regulating MC2-R mRNA stability or translatability. A phylogenetic analysis of the mouse, rat and human MC2-R genes indicates the existence of an exon 3 homologue in the rat but not in the human (data not shown). Unlike rodent adipose tissue, human adipose tissue does not express MC2-R, possibly as a consequence of the lack of a region homologous to the alternative promoter and first exon (Kubo et al. 2004) although MC2-R is expressed during early human adipogenesis (Smith et al. 2003). Perhaps, the absence of an exon 3 homologue in the human gene is a consequence of the lack of expression of MC2-R at later times during adipogenesis in the human.
Exon 3 is expressed at very much lower levels in Y1 cells than in either adrenal tissue or adipocytes and this was confirmed using exon 3-specific primers. Y1 cells are rapidly growing compared to MC2-R-expressing cells within the adrenal cortex, which are more comparable to differentiated adipocytes, having reduced proliferative capacity (Mitani et al. 1999). It is possible that the under-expression of exon 3-containing message in Y1 cells indicates that the inclusion of this exon is under both trophic and tissue-specific control, increasing the likelihood that it plays a functional role in the regulation of MC2-R expression.
In conclusion, we have identified a novel exon in the 5' UTR of MC2-R transcripts. This exon, which is relatively abundant in adipose tissues and cells, extends the length of the 5' UTR and introduces three uORFs. This suggests that during adipogenesis the murine MC2-R gene is under translational as well as transcriptional control. Investigation of the roles of splicing and the influence of the 5' UTRs on translation will be the subject of future investigations.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Cammas FM, Kapas S, Barker S & Clark AJ 1995 Cloning, characterization and expression of a functional mouse ACTH receptor. Biochemical and Biophysical Research Communications 212 912918.[CrossRef][Web of Science][Medline]
Cammas FM, Pullinger GD, Barker S & Clark AJ 1997 The mouse adrenocorticotropin receptor gene: cloning and characterization of its promoter and evidence for a role for the orphan nuclear receptor steroidogenic factor 1. Molecular Endocrinology 11 867876.
Gerlitz G, Jagus R & Elroy-Stein O 2002 Phosphorylation of initiation factor-2 alpha is required for activation of internal translation initiation during cell differentiation. European Journal of Biochemistry 269 28102819.[Web of Science][Medline]
Gondo S, Yanase T, Okabe T, Tanaka T, Morinaga H, Nomura M, Goto K & Nawata H 2004 SF-1/Ad4BP transforms primary long-term cultured bone marrow cells into ACTH-responsive steroidogenic cells. Genes To Cells 9 12391247.
Hatano O, Takakusu A, Nomura M & Morohashi K 1996 Identical origin of adrenal cortex and gonad revealed by expression profiles of Ad4BP/SF-1. Genes To Cells 1 663671.[Abstract]
Kubo M, Ishizuka T, Kijima H, Kakinuma M & Koike T 1995 Cloning of a mouse adrenocorticotropin receptor-encoding gene. Gene 153 279280.[CrossRef][Web of Science][Medline]
Kubo M, Shimizu C, Kijima H, Ishizuka T, Takano K, Takano A & Koike T 2000 Alternate exon in the 5'-untranslated region of the human ACTH receptor gene. Endocrine Journal 47 543548.[Web of Science][Medline]
Kubo M, Shimizu C, Kijima H, Nagai S & Koike T 2004 Alternate promoter and 5'-untranslated exon usage of the mouse adrenocorticotropin receptor gene in adipose tissue. Endocrine Journal 51 2530.[CrossRef][Web of Science][Medline]
Meijer HA & Thomas AA 2002 Control of eukaryotic protein synthesis by upstream open reading frames in the 5'-untranslated region of an mRNA. Biochemical Journal 367 111.[CrossRef][Web of Science][Medline]
Mitani F, Mukai K, Miyamoto H, Suematsu M & Ishimura Y 1999 Development of functional zonation in the rat adrenal cortex. Endocrinology 140 33423353.
Morris DR & Geballe AP 2000 Upstream open reading frames as regulators of mRNA translation. Molecular and Cellular Biology 20 86358642.
Morris DG, Kola B, Borboli N, Kaltsas GA, Gueorguiev M, McNicol AM, Ferrier R, Jones TH, Baldeweg S, Powell M et al. 2003 Identification of adrenocorticotropin receptor messenger ribonucleic acid in the human pituitary and its loss of expression in pituitary adenomas. Journal of Clinical Endocrinology and Metabolism 88 60806087.
Mount SM 1982 A catalogue of splice junction sequences. Nucleic Acids Research 10 459472.
Nankova BB, Kvetnansky R & Sabban EL 2003 Adrenocorticotropic hormone (MC-2) receptor mRNA is expressed in rat sympathetic ganglia and upregulated by stress. Neuroscience Letters 344 149152.[CrossRef][Web of Science][Medline]
Noon LA, Clark AJ & King PJ 2004 A peroxisome proliferator-response element in the murine mc2-r promoter regulates its transcriptional activation during differentiation of 3T3-L1 adipocytes. Journal of Biological Chemistry 279 2280322808.
Noon LA, Clark AJL, OShaughnessy PJ & King PJ 2007 A C/EBP site at 87 is required for the activation of a novel murine melanocortin 2 receptor (MC2-R) promotor at late stages during adipogenesis. Endocrinology (in press).
OShaughnessy PJ, Fleming LM, Jackson G, Hochgeschwender U, Reed P & Baker PJ 2003 Adrenocorticotropic hormone directly stimulates testosterone production by the fetal and neonatal mouse testis. Endocrinology 144 32793284.
Reynolds K, Zimmer AM & Zimmer A 1996 Regulation of RAR beta 2 mRNA expression: evidence for an inhibitory peptide encoded in the 5'-untranslated region. Journal of Cell Biology 134 827835.
Shimizu C, Kubo M, Saeki T, Matsumura T, Ishizuka T, Kijima H, Kakinuma M & Koike T 1997 Genomic organization of the mouse adrenocorticotropin receptor. Gene 188 1721.[CrossRef][Web of Science][Medline]
Simpson ER & Waterman MR 1983 Regulation by ACTH of steroid hormone biosynthesis in the adrenal cortex. Canadian Journal of Biochemistry and Cell Biology 61 692707.[Web of Science][Medline]
Slominski A, Ermak G & Mihm M 1996 ACTH receptor, CYP11A1, CYP17 and CYP21A2 genes are expressed in skin. Journal of Clinical Endocrinology and Metabolism 81 27462749.[Abstract]
Smith SR, Gawronska-Kozak B, Janderova L, Nguyen T, Murrell A, Stephens JM & Mynatt RL 2003 Agouti expression in human adipose tissue: functional consequences and increased expression in type 2 diabetes. Diabetes 52 29142922.
Zhong Q, Sridhar S, Ruan L, Ding KH, Xie D, Insogna K, Kang B, Xu J, Bollag RJ & Isales CM 2005 Multiple melanocortin receptors are expressed in bone cells. Bone 36 820831.[Medline]
Received in final form 3 July 2006
Accepted 3 July 2006
Made available online as an Accepted Preprint 15 August 2006
This article has been cited by other articles:
![]() |
S. Kreth, C. Ledderose, I. Kaufmann, G. Groeger, and M. Thiel Differential expression of 5'-UTR splice variants of the adenosine A2A receptor gene in human granulocytes: identification, characterization, and functional impact on activation FASEB J, September 1, 2008; 22(9): 3276 - 3286. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |