|
|
||||||||
Metabolic Disease Research, Global Pharmaceutical Products Division, Abbott Laboratories, R4MJ, Bldg. AP9A, 100 Abbott Park Road, Abbott Park, Illinois 60064-6099, USA
(Requests for offprints should be addressed to D G Fry; Email: dennis.fry{at}abbott.com)
(Current address of W Kaszubska is Corporate Global Product Development, Serono International, S.A., 15bis, chemin des Mines, 1211 Geneva, Switzerland)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Recently, a natural ligand for GHS-R was identified. Ghrelin is a 28-amino acid, octanoylated peptide secreted primarily by the upper intestinal tract (Kojima et al. 1999). It is a potent dose-dependent GHS in rodents (Saito et al. 2003) and humans (Peino et al. 2000, Takaya et al. 2000). However, ghrelin function is not restricted to GH release, as it has been shown to be an important regulator of food intake and body weight (Horvath et al. 2003). Ghrelin plasma levels rise before meals and fall following feeding (Cummings et al. 2001). Ghrelin infusion in near-physiological doses increases hunger in humans (Wren et al. 2001) and adiposity in rodents (Tschöp et al. 2000). Consistent with high sequence homology to motilin, ghrelin stimulates gastric contractility and acid secretion (Masuda et al. 2000).
Although ghrelin was isolated and purified from the oxyntic mucosa of the stomach (Kojima et al. 1999, Date et al. 2000), it is produced in other tissues, albeit at lower levels. These include not only the hypothalamus (Cowley et al. 2003) and pituitary (Korbonits et al. 2001), the sites of GHS-R expression, but also the pancreas, kidney, liver, heart, lung, ovary, prostate, and the placenta (Gnanapavan et al. 2002). The full-length ghrelin receptor, GHS-R1a, is expressed mainly in the GH-producing cells of the pituitary (Adams et al. 1998, Korbonits et al. 1998, Skinner et al. 1998, Korbonits et al. 2001). It is also found in the hypothalamus where it is thought to mediate the orexigenic (appetite stimulating) effects of ghrelin in addition to stimulating GHRH-neurons (Howard et al. 1996). Recently, GHS-R expression has also been identified in afferent vagal neurons. It was shown that ghrelin-induced increase of feeding in rats is dependent on an intact vagal nerve (Date et al. 2002). Therefore, ghrelin appears to be a physiological link between the stomach, the pituitary, and the hypothalamus.
GHS-R expression and activity have been well characterized in a variety of cell systems (Smith et al. 1997, Kojima et al. 1999). Activation of the receptor by ghrelin, peptidomimetics or small-molecule agonists is coupled via G
q-proteins to the phospholipase C pathway, leading to inositol trisphosphate (IP) and diacylglycerol (DAG) production. The elevation of IP produces a subsequent increase in cytosolic intracellular Ca2+ concentration ([Ca2+]i) from intracellular stores. In parallel, DAG stimulates protein kinase C (PKC), leading to activation of the mitogen-activated protein kinase (MAPK) pathway. The MAPK pathway has been identified as responsible for mitogenic and antiapoptotic effects of ghrelin (Kim et al. 2004, Nanzer et al. 2004). GHS-R activation also results in activation of L-type Ca2+ channels and influx of Ca2+ from the extracellular milieu (Smith et al. 1997, Glavaski-Joksimovic et al. 2003).
There is substantial evidence that GHS-R in such systems displays a high level of constitutive activity (Holst et al. 2003, 2004, Holst & Schwartz 2004). While treatment with inverse agonists such as substance P and related analogs has been shown to effectively suppress this activity, it remains to be determined whether the constitutive activity seen in recombinant GHS-R expression has physiological relevance in vivo.
As cell lines are much more convenient for receptor pharmacology studies than either primary cell preparations or direct in vivo studies, our aim was to identify and characterize the functional activity of endogenously expressed GHS-R in a physiologically relevant cell line. We reasoned that such a cell line might provide a useful intermediate between recombinant cell lines and primary cell preparations for elucidating GHS-R signaling. We identified RC-4B/C cells (Hurbain-Kosmath et al. 1990) derived from an anterior pituitary adenoma of a male rat as a suitable in vitro system for this purpose. We demonstrate here that RC-4B/C cells respond to ghrelin treatment with an increase in [Ca2+]i that is blocked by GHS-R antagonists. Additionally, we isolated a subclone of the parental RC-4B/C cells, RC-4B/C.40, which demonstrated a more robust and stable ghrelin response in a Ca2+ mobilization assay. As a more homogeneous cell population with enhanced GHS-R expression, the subclone allowed for further analysis of ghrelin signaling, including characterization of the ghrelin-induced Ca2+pathways. It appears that the RC-4B/C.40 cells signal through Gq in a manner similar to Chinese hamster ovary (CHO)-K1 cells expressing human GHS-R (CHO-hGHS-R). However, when using a phosphatidylinositol (PI) hydrolysis assay, we did not observe the level of constitutively active GHS-R in the RC-4B/ C.40 cells that occurs in the recombinant CHO line. This observation seems particularly interesting in that it may be the first reported example of a nonconstitutively active, functional GHS-R in a relevant pituitary cell line. Overall, our results indicate that RC-4B/C parental and RC-4B/C.40 cells are potentially useful in vitro systems for the characterization of GHS-R agonists and antagonists. Furthermore, these cell lines may provide a better model of ghrelin signaling in vivo.
| Materials and methods |
|---|
|
|
|---|
CHO-hGHS-R (Euroscreen s.a. Brussels, Belgium) were cultured in Ultra-CHO medium from Cambrex Bio Science (Walkersville, MD, USA) supplemented with 1% dialyzed fetal bovine serum (FBS), 50 µg/ml gentamicin, and 400 µg/ml G418 (all from Invitrogen) at 37 °C in a humidified cell incubator containing 5% CO2. Rat pituitary adenoma cells, RC-4B/C (CRL-1903; ATCC, Manassas, VA, USA), were cultured in a 1:1 mixture of Dulbeccos Modified Eagles Medium (Sigma) and Minimum Essential Alpha Medium (Invitrogen) supplemented with 0.01 mM non-essential amino acids (Sigma), 15 mM HEPES (Sigma), 2.5 ng/ml epidermal growth factor (Invitrogen), and 10% dialyzed, heat-inactivated FBS at 37 °C in a humidified cell incubator containing 5% CO2. Sub-cloning of the parental population was performed by limiting dilution cloning in 96-well tissue culture plates using a conditioned RC-4B/C media. Conditioned media was prepared by incubation on a confluent monolayer of RC-4B/C cells for 24 h, after which time the media was decanted, filtered through a 0.22 µm filter, and stored at 4 °C until use.
Reagents
GHS-R agonist hexarelin (His-D-2-methyl-Trp-Ala-Trp-D-Phe-Lys) was purchased from American Peptide Inc. (Sunnyvale, CA, USA), rat ghrelin (Gly-Ser-Ser (n-octanoyl)-Phe-Leu-Ser-Pro-Glu-His-Gln-Lys-Ala-Gln-Gln-Arg-Lys-Glu-Ser-Lys-Lsy-Pro-Pro-Ala-Lys-Leu-Gln-Pro-Arg) was synthesized at Abbott, and rat des-octanoyl ghrelin was either purchased from Phoenix Pharmaceuticals Inc. (Belmont, CA, USA) or synthesized at Abbott. GHS-R antagonist [D-Lys3]-GHRP-6 (H-His-D-Trp-D-Lys-Trp-D-Phe-Lys) and the inverse agonist (D-Arg1, D-Phe5, D-Trp7,9, Leu11)-substance P analog were purchased from Bachem Bioscience Inc. (King of Prussia, PA, USA). The PLC inhibitor U-73122 was purchased from BIOMOL. Thapsigargin was purchased from Alexis Biochemicals (Lausen, Switzerland). [3H]myoinositol was purchased from Perkin-Elmer (Shelton, CT, USA). AG1-X8 anion-exchange resin columns were purchased from Bio-Rad. The L-type calcium channel blocker nifedipine, Ptx, and myoinositol were purchased from Sigma. Compounds A and B were synthesized at Abbott.
Reverse transcriptase PCR (RT-PCR)
Total RNA was isolated from cell pellets using TRI-reagent (Sigma) according to the manufacturers specifications. First-strand cDNA was generated using the SuperScript First-Stand Synthesis System (Invitrogen) with oligo (dT) primers and 5 µg total RNA. The target cDNA was then amplified by PCR. The reaction contained 10 x PCR buffer (Invitrogen), 200 nM dNTP mix, 1.5 mM MgCl2, 200 nM primers to human GHS-R1a, 5'TCTTCCTTCCTGTCTTCTGTC3' (sense) and 5'AGTCTGAACACTGCCACC3' (anti-sense), and platinum Taq DNA polymerase (Invitrogen) in 50 µl total volume. Thermal cycling consisted of 5 min at 95 °C followed by 40 cycles of 30 s at 95 °C, 30 s at 50 °C, 2 min at 72 °C, and was concluded with 10 min at 72 °C.
Fluorescent calcium indicator (FLIPR) assay
Agonist EC50/antagonist IC50 determinations
RC-4B/C parental or RC-4B/C.40 cells were plated in black 96-well plates with clear bottoms (Corning Inc. Corning, NY, USA) and cultured to confluency overnight in growth medium at 37 °C in a humidified cell incubator containing 5% CO2. Growth medium was replaced with 100 µl Dulbeccos PBS (DPBS) containing 1000 mg/l D-glucose, 36 mg/l sodium pyruvate (Invitrogen) supplemented with 1.14 mM Fluo-4 AM (Molecular Probes, Eugene, OR, USA) and 2.5 mM probenecid (Sigma) for 13 h in the dark at room temperature. For EC50 determinations, various concentrations of agonist were prepared at 4 x final concentrations in DPBS containing 0.1% BSA.
After aspirating the dye solution, cells were washed three times in DPBS using an ELx-405 Automatic Plate Washer (Bio-Tek Instruments, Winooski, VT, USA). Following the last wash, cells were placed in 150 µl/well of DPBS and the plates were then transferred to the FLIPR unit (Molecular Probes) where 50 µl of 4 x agonist doses were added and the agonist-induced rise of [Ca2+]i detected by Fluo-4AM fluorescence was followed for 3 min. Fluorescence emissions from 96 wells were measured simultaneously at excitation and emission wavelengths of 488 and 520 nm respectively for 3 min in 1-s intervals for the first minute and 5-s intervals thereafter. Agonist activity was thus expressed as percent activation with an EC50 being the concentration of agonist causing a 50% activation of a maximal ghrelin response. For IC50 determinations, after loading with dye solution, washing, and replacing with 100 µl DPBS, cell plates were placed in FLIPR where 50 µl/well of 4 x antagonist concentrations were added and measurements taken for 36 min, followed by the addition of 50 µl/well of 4 x ghrelin ligand in DPBS/0.1% BSA (final concentration of 3 or 10 nM for RC-4B/C cells and 1 nM for CHO-hGHS-R cells). Fluorescence measurements were then taken for another 3 min. IC50 s were determined as the concentration of antagonist causing a 50% reduction of the ghrelin-induced calcium signal. Sigmoidal curves were fitted by GraphPad Prism software (GraphPad Software, Inc., San Diego, CA, USA) and EC50 or IC50 values were calculated based on results from triplicate determinations.
Effects of pertussis (Ptx)
RC-4B/C.40 cells were exposed to 1000 ng/ml Ptx for 4 h, 37 °C. At the end of the 4 h incubation, the culture medium was aspirated, 100 µl DPBS containing glucose and pyruvate were added to each well along with 100 µl calcium assay reagent (Molecular Devices, Sunnyvale, CA, USA) containing 2.5 mM probenecid. Cells were analyzed in the FLIPR for their response to rat ghrelin as described in the previous subsection.
Effects of extracellular and intracellular Ca2+
The role of extracellular Ca2+ in ghrelin signaling in RC-4B/C.40 cells was determined as described above, except that after loading with Fluo-4 AM dye solution, cells were washed a minimum of three times in Ca2+/Mg2+-free DPBS, and then stimulated with rat ghrelin in either standard Ca2+/Mg2+-containing or Ca2+/Mg2+-free DPBS. To further define the role of extracellular Ca2+, cells were also pretreated with the L-type calcium channel blocker, nifedipine. Briefly, after washing three times in Ca2+/Mg2+-free DPBS, cells were transferred to the FLIPR unit where 150 µl of a 1.5 x dose of nifedipine was added (for a final concentration of 100 µM), and the signal was monitored for 6 min. Following pretreatment with nifedipine, cells were stimulated with 10 nM ghrelin and the effects on [Ca2+]i were monitored for an additional 3 min. To assess the role of Ca2+ release from intracellular stores, RC-4B/C.40 cells were washed in Ca2+/Mg2+-free DPBS and pretreated with 1 µM thapsigargin in Ca2+/Mg2+-free DPBS (causing Ca2+ release from intracellular stores and preventing re-uptake into the endoplasmic reticulum). The thapsigargin-induced release of intracellular Ca2+ was monitored in FLIPR for a minimum of 6 min (allowing for the return of signal to baseline). Cells were then stimulated with rat ghrelin in either Ca2+/Mg2+-free or Ca2+/Mg2+-containing DPBS. The ghrelin-induced fluorescence signal was monitored on FLIPR for an additional 5 min. The resultant fluorescent signal tracings were normalized to the basal signal in Ca2+/Mg2+-free DPBS using FLIPR software and further analyzed in GraphPad Prism (GraphPad Software).
PI hydrolysis assay
The constitutive activity of GHS-R in RC-4B/C.40 and CHO-hGHS-R cells was determined using a PI hydrolysis assay that measures the accumulation of [3H]inositol phosphates following activation of GHS-R. Briefly, cells were seeded at 5 x 105 cells/well in 24-well plates and cultured for 24 h. Cells were then labeled for 1618 h with [3H]myoinositol (2 µCi/well). After washing with room temperature DPBS, cells were treated with 200 µl/well of 10 mM LiCl in Earles/25 mM HEPES/0.0073 mM pepstatin/0.1 mM PMSF buffer for 4560 min at 37 °C in a 5% CO2 incubator to block endogenous inositol mono-phosphatase activity. Next, cells were stimulated with either ghrelin or [D-Arg1, D-Phe5, D-Tryp7,9, Leu11]-substance P analog for 30 min at 37 °C. Cells were lysed by the addition of 50 µl/well of 1 N NaOH followed by an equal volume of 1 N HCl. Samples were then transferred to 12 x 75 mm glass tubes, extracted by adding 1.5 ml/tube of chloroform/methanol (1:2, v/v), vortexed gently, and incubated for 1 h at room temperature. Additional 0.5 ml/tube volumes of chloroform were added followed by 0.4 ml/tube of double distilled(dd) H2O. Following centrifugation at 1100 g for 20 min at room temperature, the aqueous phase was diluted to 3 ml with ddH2O. Samples were loaded onto AG1-X8 columns and washed with 20 ml ice-cold, non-radioactive myoinositol, followed by 6 ml 60 mM sodium formate/5 mM sodium tetraborate. The [3H]inositol phosphate fraction was eluted with 5 ml 1 M ammonium formate/0.1 N formic acid. Total counts per minute (CPM) were determined in a Beckman LS 6500 scintillation counter.
| Results |
|---|
|
|
|---|
A single product of the expected size (349 bp) was generated by RT-PCR using cDNA derived from the RC-4B/C cell line (Fig. 1
, lane c). The corresponding negative control reaction lacking the RT did not yield any products (Fig. 1
, lane d), thus ruling out potential contamination by genomic DNA in the RNA isolation. PC3, a prostate cancer cell line that was previously shown to express GHS-R (Volante et al. 2002), yielded a product of expected size (Fig. 1
, lane b). In addition, cDNA from CHO-GHS-R cells and a vector encoding GHS-R1a were used as positive controls. Taken together, these observations suggest that RC-4B/C cells express GHS-R1a mRNA.
|
RC-4B/C parental cells
We next investigated whether the RC-4B/C cell line, expressing an endogenous GHS-R1a, could be used as a reagent for screening of GHS-R agonists and antagonists in vitro. To determine the functional activity of GHS-R, we measured [Ca2+]i using fluorescence imaging. RC-4B/C cells were treated with ghrelin, hexarelin, and des-octanoyl ghrelin, an inactive form of ghrelin serving as a negative control. These peptides were tested at half-log concentrations and their activity expressed as percent maximal activation. Both ghrelin and hexarelin demonstrated a robust dose-dependent response in the RC-4B/C cells with EC50 values of 1.04 nM and 1.67 nM respectively (Fig. 2A
). Des-octanoylated ghrelin, on the other hand, did not elicit a signal at any of the doses tested (Fig. 2A
), indicating that the ghrelin response in the RC-4B/C cells is specific to its active form. We also tested the effects of GHS-R antagonists in this assay. Preincubation of RC-4B/C cells with a known peptidyl antagonist [D-Lys-3]-GHRP-6 and compound A resulted in a dose-dependent inhibition of ghrelin-induced increase in Ca2+ flux, with IC50 values of 3.86 µM and 73.1 nM respectively (Fig. 2B
). Compound B, a structural homolog of compound A, was also tested and found to be inactive (Fig. 2B
). This finding is in agreement with the poor affinity that compound B displayed for GHS-R in a binding assay (data not shown).
|
|
|
In order to further characterize ghrelin signaling in the RC-4B/C.40 subclone, we pretreated cells with Ptx, which specifically inhibits Gi and Go coupling, or with the PLC inhibitor U-73122, which blocks the signal downstream of Gq activation that ultimately causes the rise of [Ca2+]i measured in FLIPR. Pretreatment with 1 µg/ml Ptx for 4 h at 37 °C did not affect the ghrelin doseresponse, although the maximal signal attained was slightly higher (Fig. 5A
). On the other hand, pretreatment with 1 µM, 3 µM, and 10 µM U-73122 resulted in a dose-dependent inhibition of the ghrelin response (Fig. 5B
). Taken together, these results suggest that ghrelin signaling in RC-4B/C.40 cells occurs primarily through Gq and not Gi or Go coupling.
|
|
|
The constitutive activity of GHS-R in the RC-4B/C.40 and the recombinant CHO-hGHS-R cells was evaluated using a PI hydrolysis assay that measures the accumulation of [3H]inositol phosphates from [3H]myoinositol turnover. In accordance with the G-protein coupled receptor (GPCR) signaling paradigm, ghrelin or basal stimulation of GHS-R presumably activates Gq, which, in turn, activates PLC, resulting in the formation of 1,4,5-triphosphate (IP3) from phosphatidylinositol 4,5-bisphosphate (PI (4,5) P2). The increase in IP3 then causes intracellular Ca2+ release. CHO-hGHS-R cells exhibit a basal level of constitutive GHS-R activity, which increased by 40% upon stimulation with 100 nM ghrelin (Fig. 8A
). Treatment with 50 nM [D-Arg1, D-Phe5, D-Trp7,9, Leu11]-substance P analog, a known GHS-R inverse agonist (Holst et al. 2003), resulted in a statistically significant 37% reduction of the basal activity (P value < 0.005), indicating that GHS-R overexpressed in the CHO line constitutively exhibits about 50% of maximal activity under basal conditions, as reported in other recombinant cell systems (Holst et al. 2003). In contrast, endogenous GHS-R in RC-4B/ C.40 cells does not exhibit significant constitutive activity (Fig. 8B
). Stimulation with 100 nM ghrelin resulted in an 88% increase of [3H]inositol phosphate over that detected under basal conditions as expected. However, unlike in CHO-hGHS-R cells, treatment with 10 nM and 100 nM [D-Arg1, D-Phe5, D-Trp7,9, Leu11]-substance P analog did not result in any significant reduction of basal activity, suggesting that constitutive activity of GHS-R in the RC-4B/C.40 cells is undetectably low.
|
| Discussion |
|---|
|
|
|---|
The elucidation of the second messenger system involved in GHS-R signaling is an area of great interest. Earlier studies involving activation of GHS-R by artificial GHSs showed a variety of responses such as an increase in intracellular cAMP and free Ca2+ levels as well as activation of PKA and PKC (Chen 2000). Recently, the ghrelin-stimulated GHS-R signal transduction pathway has been investigated in isolated porcine somatotrophs. It was shown that ghrelin increased the [Ca2+]i in 98% of the cells that responded to GHRH, an effect that was decreased in the presence of a GHS-R peptidic antagonist [D-Lys-3]-GHRP-6 (Glavaski-Joksimovic et al. 2003). In addition, another report demonstrated a ghrelin dose-dependent increase in the [Ca2+]i in rat-derived single hypothalamic neuropeptide Y-neurons, known for their critical role in the stimulation of food intake (Kohno et al. 2003).
Ghrelin and hexarelin have previously been shown to be equipotent in a binding assay using pituitary membrane preparations (Muccioli et al. 2001). We show here that ghrelin and hexarelin, a non-natural peptidyl GHS (Arvat et al. 2001), activated GHS-R in RC-4B/C cells with similar potency, as judged by an increase in the [Ca2+]i. Their EC50 values in RC-4B/C cells are comparable to those obtained using CHO cells overexpressing GHS-R (data not shown). In contrast, des-octanoyl ghrelin, a precursor that is devoid of the endocrine activity of acylated ghrelin (Broglio et al. 2003), had no effect on the [Ca2+]i in RC-4B/C cells. In addition, antagonists of GHS-R blocked the ghrelin-induced increase in [Ca2+]i. Compound A was more potent than [D-Lys-3]-GHRP-6, consistent with their relative affinities for GHS-R in a radiolabeled ghrelin binding assay using membrane preparations of CHO cells overexpressing GHS-R (data not shown). Compound B, a structural homolog of compound A but with a weak binding affinity for GHS-R, was inactive in the [Ca2+]i flux assay.
While effective as an in vitro tool for screening GHS-R pharmacophores, the RC-4B/C cells proved to be unsuitable for further characterization of ghrelin signal transduction, possibly due to being a heterogeneous cell population. Moreover, a consistent pattern of diminished ghrelin responsiveness during cell culture was observed, which further limited their utility as an in vitro screening tool. In an attempt to overcome these limitations, a subclone RC-4B/C.40, was generated. It demonstrated the most stable and highest magnitude of ghrelin response compared with both the parental RC-4B/C cells and other subclones. Like the parental cells, RC-4B/C.40 cells showed a robust response to both rat ghrelin and the peptide agonist hexarelin, while no response was observed with des-octanoyl ghrelin treatment. Likewise, treatment with the peptide antagonist [D-Lys3]-GHRP-6 or the small molecule inhibitor, compound A, effectively blocked the ghrelin response, while the structural analog, compound B, was essentially inactive.
A number of reports have identified molecules potentially involved in the ghrelin-induced Ca2+ signaling pathway. For example, using enzyme inhibitors, it was shown that adenylyl cyclase and PLC are involved in GHS-R signaling in somatotropes (Glavaski-Joksimovic et al. 2003), and PKA in the hypothalamic neurons (Kohno et al. 2003). Using calcium channel blockers, it was also demonstrated that L-type channels are essential for Ca2+ influx in somatotropes (Glavaski-Joksimovic et al. 2003) and N-type channels in hypothalamic neurons (Kohno et al. 2003). As a homogeneous cell population, the RC-4B/C.40 subclone provided the means to investigate ghrelin signal transduction. We demonstrate here that treatment with Ptx, which inhibits Gi and Go coupling, had no effect on the ghrelin signal, while pretreatment with the PLC inhibitor U-73122 dose-dependently blocked the ghrelin signal in RC-4B/C.40 cells, suggesting that signaling occurs primarily through Gq coupling, as expected. We also demonstrated that the ghrelin-induced [Ca2+]i flux in RC-4B/C.40 cells is dependent on both influx of extracellular Ca2+, consistent with observations in isolated somatotropes, and release from intracellular stores. Removal of Ca2+ from the cell medium greatly reduced the overall magnitude and duration of the ghrelin-induced increase in [Ca2+]i, as did incubation with the L-type channel blocker nifedipine, indicating the involvement of calcium channels in the ghrelin response. The release of intracellular Ca2+ stores by thapsigargin also effectively blocked the ghrelin response in the absence of extracellular Ca2+. Taken together, these observations indicate that ghrelin signaling through GHS-R involves the release of Ca2+ from intracellular stores as well as influx of extracellular Ca2+ through plasma membrane ion channels.
Recent studies involving GHS-R expression in recombinant cell systems have reported a high degree of constitutive activity, similar to that observed with several other GPCRs, including the neurotensin receptor 2 (NT-R2) and the viral ORF-74 receptor (Holst et al. 2003, Holst & Schwartz 2004). Using inositol phosphate turnover and a cAMP response element-dependent transcriptional reporter assay to assess constitutive activity, Schwartz and colleagues demonstrated that GHS-R transiently expressed in COS-7 and HEK 293 cells signals at about 50% maximal activation in the absence of ghrelin (Holst et al. 2003). Stimulation with ghrelin results in a twofold increase in activity, while treatment with the inverse agonist [D-Arg1, D-Phe5, D-Tryp7,9, Leu11]-substance P analog potently suppresses basal activity. The constitutive activity of GHS-R in these recombinant cell systems may be an artifact of receptor overexpression. However, the structurally homologous motilin receptor does not show measurable constitutive activity when expressed in a recombinant system, suggesting that high constitutive activity may in fact be an intrinsic, physiologically relevant property of GHS-R (Holst et al. 2003, Holst & Schwartz 2004).
We decided to investigate the constitutive activity of GHS-R in the RC-4B/C.40 cells using a PI hydrolysis assay and compare it with the level of activity in the recombinant CHO-hGHS-R cells. The CHO-hGHS-R cells exhibited a high degree of constitutive activity, which was reduced upon treatment with the inverse agonist [D-Arg1, D-Phe5, D-Tryp7,9, Leu11]-substance P analog, in agreement with the effects observed in other recombinant cell systems (Holst et al. 2003, 2004, Holst & Schwartz 2004). In contrast, the RC-4B/C.40 cells showed little, if any, constitutive activity. The basal inositol phosphate level was threefold less than in the CHO cells and was not further reduced by treatment with the inverse agonist [D-Arg1, D-Phe5, D-Tryp7,9, Leu11]-substance P analog.
Thus, the endogenously expressed GHS-R in RC-4B/C.40 cells does not exhibit constitutive activity in our hands. As this runs counter to what has recently been reported in several recombinant cell lines, our observations raise important questions as to the physiological relevance of GHS-R constitutive activity. A possible explanation for the disparity between the levels of constitutive activity in the recombinant CHO line versus the RC-4B/C.40 cells is the presence of an intracellular regulator of GHS-R signaling, which functions to suppress GHS-R constitutive activity. Presumably, such an intracellular regulator would not be expressed in the recombinant CHO-hGHS-R line where its absence may account for the high level of constitutively active GHS-R observed, while a more physiologically relevant pituitary cell line, RC-4B/C, may express the regulator, accounting for the low level of constitutive activity in this cell line. Alternatively, as with the MC-4 receptor, where AgRP functions as an inverse agonist, there may be an unidentified endogenous inverse agonist that attenuates GHS-R constitutive activity and may play a critical role in mediating the effects on the complex network of neuroendocrine inputs to ghrelin effector cells (Nijenhuis et al. 2001, Holst et al. 2003). However, such an endogenous inverse agonist would most likely only be observed in an in vivo setting and not in a homogeneous cell population in vitro. Nonetheless, the RC-4B/C.40 cells may ultimately provide a more relevant cell line in which to model and investigate ghrelin signaling than what can be currently achieved using recombinant GHS-R cell systems.
In conclusion, we have identified a suitable cell line for GHS-R pharmacology and signaling studies. The rat anterior pituitary RC-4B/C cells express endogenous GHS-R that responds to ghrelin as judged by increased [Ca2+]i. GHS-R antagonists blocked the ghrelin response with the anticipated rank order of potency. Additionally, we were able to identify and characterize a subclone, RC-4B/C.40, which demonstrated a more robust and stable ghrelin response than that observed in the parental cells. Along with showing agonist and antagonist effects similar to those observed in the parental RC-4B/C cells and in CHO-hGHS-R cells, the RC-4B/C.40 subclone also provided the means to more fully characterize ghrelin signaling. The mechanism of ghrelin-induced increase in [Ca2+]i in the RC-4B/C.40 cells involves Gq coupling along with both extracellular Ca2+flux and release of Ca2+from intracellular stores. The lack of constitutive activity of GHS-R in RC-4B/C.40 cells indicates that GHS-R functions differently in this more physiologically relevant cell type than in recombinant cell lines. Thus, the RC-4B/C parental and RC-4B/C.40 cell lines described here represent useful in vitro tools for the identification of GHS-R agonists or antagonists with potential therapeutic applications in the treatment of growth hormone deficiency or body weight disorders, and, more significantly, for examination of the mechanism of GHS-R activation and signaling, including the basis of constitutive activity.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Arvat E, Maccario M, di Vito L, Broglio F, Benso A, Gottero C, Papotti M, Muccioli G, Dieguez C, Casanueva FF et al. 2001 Endocrine activities of ghrelin, a natural growth hormone secretagogue (GHS), in humans: comparison and interactions with hexarelin, a nonnatural peptidyl GHS, and GH-releasing hormone. Journal of Clinical Endocrinology and Metabolism 86 11691174.
Broglio F, Benso A, Gottero C, Prodam F, Gauna C, Filtri L, Arvat E, van der Lely AJ, Deghenghi R & Ghigo E 2003 Non-acylated ghrelin does not possess the pituitaric and pancreatic endocrine activity of acylated ghrelin in humans. Journal of Endocrinological Investigation 26 192196.[Web of Science][Medline]
Caminos JE, Nogueiras R, Blanco M, Seoane LM, Bravo S, Alvarez CV, García Caballero T, Casanueva FF & Diéguez C 2003 Cellular distribution and regulation of ghrelin messenger ribonucleic acid in the rat pituitary gland. Endocrinology 144 50895097.
Chen C 2000 Growth hormone secretagogue actions on the pituitary gland: multiple receptors for multiple ligands? Clinical and Experimental Pharmacology and Physiology 27 323329.[CrossRef][Web of Science][Medline]
Cowley MA, Smith RG, Diano S, Tschöp M, Pronchuk N, Grove KL, Strasburger CJ, Bidlingmaier M, Esterman M, Heiman ML et al. 2003 The distribution and mechanism of action of ghrelin in the CNS demonstrates a novel hypothalamic circuit regulating energy homeostasis. Neuron 37 649661.[CrossRef][Web of Science][Medline]
Cummings DE, Purnell JQ, Frayo RS, Schmidova K, Wisse BE & Weigle DS 2001 A preprandial rise in plasma ghrelin levels suggests a role in meal initiation in humans. Diabetes 50 17141719.
Date Y, Kojima M, Hosoda H, Sawaguchi A, Mondal MS, Suganuma T, Matsukura S, Kangawa K & Nakazato M 2000 Ghrelin, a novel growth hormone-releasing acylated peptide, is synthesized in a distinct endocrine cell type in the gastrointestinal tracts of rats and humans. Endocrinology 141 42554261.
Date Y, Murakami N, Toshinai K, Matsukura S, Niijima A, Matsuo H, Kangawa K & Nakazato M 2002 The role of the gastric afferent vagal nerve in ghrelin-induced feeding and growth hormone secretion in rats. Gastroenterology 123 11201128.[CrossRef][Web of Science][Medline]
Ghigo E, Arvat E, Giordano R, Broglio F, Gianotti L, Maccario M, Bisi G, Graziani A, Papotti M, Muccioli G et al. 2001 Biologic activities of growth hormone secretagogues in humans. Endocrine 14 8793.[CrossRef][Web of Science][Medline]
Giustina A & Veldhuis JD 1998 Pathophysiology of the neuroregulation of growth hormone secretion in experimental animals and the human. Endocrine Reviews 19 717797.
Glavaski-Joksimovic A, Jeftinija K, Scanes CG, Anderson LL & Jeftinija S 2003 Stimulatory effect of ghrelin on isolated porcine somatotropes. Neuroendocrinology 77 367379.[CrossRef][Web of Science][Medline]
Gnanapavan S, Kola B, Bustin SA, Morris DG, Mcgee P, Fairclough P, Bhattacharya S, Carpenter R, Grossman AB & Korbonits M 2002 The tissue distribution of the mRNA of ghrelin and subtypes of its receptor, GHS-R, in humans. Journal of Clinical Endocrinology and Metabolism 87 2988.
Holst B & Schwartz TW 2004 Constitutive ghrelin receptor activity as a signaling set point in appetite regulation. Trends in Pharmacological Sciences 25 113117.[CrossRef][Medline]
Holst B, Cygankiewicz A, Jensen TH, Ankersen M & Schwartz TW 2003 High constitutive signaling of the ghrelin receptor-identification of a potent inverse agonist. Molecular Endocrinology 17 22012210.
Holst B, Holliday ND, Bach A, Elling CE, Cox HM & Schwartz TW 2004 Common structural basis for constitutive activity of the ghrelin receptor family. Journal of Biological Chemistry 279 5380653817.
Horvath TL, Castañeda T, Tang-Christensen M, Pagotto U & Tschöp MH 2003 Ghrelin as a potential anti-obesity target. Current Pharmaceutical Design 9 13831395.[CrossRef][Web of Science][Medline]
Howard AD, Feighner SD, Cully DF, Arena JP, Liberator PA, Rosenblum CI, Hamelin M, Hreniuk DL, Palyha OC, Anderson J et al. 1996 A receptor in pituitary and hypothalamus that functions in growth hormone release. Science 273 974977.[Abstract]
Hurbain-Kosmath I, Berault A, Noel N, Polkowska J, Bohin A, Jutisz M, Leiter EH, Beamer WG, Bedigian HG, Davisson MT et al. 1990 Gonadotropes in a novel rat pituitary tumor cell line, RC-4B/C. Establishment and partial characterization of the cell line. In Vitro Cellular and Developmental Biology 26 431440.
Kim SK, Yoon CY, Jang PG, Park YJ, Shin CS, Park HS, Ryu JW, Pak YK, Park JY, Lee KU et al. 2004 The mitogenic and antiapoptotic actions of ghrelin in 3T3-L1 adipocytes. Molecular Endocrinology 18 22912301.
Kohno D, Gao Hong Z, Muroya S, Kikuyama S & Yada T 2003 Ghrelin directly interacts with neuropeptide Y-containing neurons in the rat arcuate nucleus: Ca2+ signaling via protein kinase A and N-type channel-dependent mechanisms and cross-talk with leptin and orexin. Diabetes 52 948956.
Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H & Kangawa K 1999 Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402 656660.[CrossRef][Medline]
Korbonits M, Jacobs RA, Aylwin SJ, Burrin JM, Dahia PL, Monson JP, Honegger J, Fahlbush R, Trainer PJ, Chew SL et al. 1998 Expression of the growth hormone secretagogue receptor in pituitary adenomas and other neuroendocrine tumors. Journal of Clinical Endocrinology and Metabolism 83 36243630.
Korbonits M, Bustin SA, Kojima M, Jordan S, Adams EF, Lowe DG, Kangawa K & Grossman AB 2001 The expression of the growth hormone secretagogue receptor ligand ghrelin in normal and abnormal human pituitary and other neuroendocrine tumors. Journal of Clinical Endocrinology and Metabolism 86 881887.
Masuda Y, Tanaka T, Inomata N, Ohnuma N, Tanaka S, Itoh Z, Hosoda H, Kojima M & Kangawa K 2000 Ghrelin stimulates gastric acid secretion and motility in rats. Biochemical and Biophysical Research Communication 276 905908.
Muccioli G, Papotti M, Locatelli V, Ghigo E & Deghenghi R 2001 Binding of 125I-labeled ghrelin to membranes from human hypothalamus and pituitary gland. Journal of Endocrinological Investigation 24 RC7RC9.[Web of Science][Medline]
Nanzer AM, Kalaf S, Mozid AM, Fowkes RC, Patel MV, Burrin JM, Grossman AB & Korbonits M 2004 Ghrelin exerts a proliferative effect on a rat pituitary somatotroph cell line via the mitogen-activated protein kinase pathway. European Journal of Endocrinology 151 233240.[Abstract]
Nijenhuis WA, Oosterom J & Adan RA 2001 AgRP(83-132) acts as an inverse agonist on the human-melanocortin-4 receptor. Molecular Endocrinology 15 164171.
Peino R, Baldelli R, Rodriguez-Garcia J, Rodriguez-Segade S, Kojima M, Kangawa K, Arvat E, Ghigo E, Dieguez C & Casanueva FF 2000 Ghrelin-induced growth hormone secretion in humans. European Journal of Endocrinology 143 R11R14.[Abstract]
Saito N, Konishi K, Takeda H, Kato M, Sugiyama T & Asaka M 2003 Antigen retrieval trial for post-embedding immunoelectron microscopy by heating with several unmasking solutions. Journal of Histochemistry and Cytochemistry 51 989994.
Skinner MM, Nass R, Lopes B, Laws ER & Thorner MO 1998 Growth hormone secretagogue receptor expression in human pituitary tumors. Journal of Clinical Endocrinology and Metabolism 83 43144320.
Smith RG, Pong SS, Hickey G, Jacks T, Cheng K, Leonard R, Cohen CJ, Arena JP, Chang CH, Drisko J et al. 1996 Modulation of pulsatile GH release through a novel receptor in hypothalamus and pituitary gland. Recent Progress in Hormone Research 51 261285.[Web of Science][Medline]
Smith RG, van der Ploeg LH, Howard AD, Feighner SD, Cheng K, Hickey GJ, Wyvratt MJ Jr, Fisher MH, Nargund RP & Patchett AA 1997 Peptidomimetic regulation of growth hormone secretion. Endocrine Reviews 18 621645.
Takaya K, Ariyasu H, Kanamoto N, Iwakura H, Yoshimoto A, Harada M, Mori K, Komatsu Y, Usui T, Shimatsu A et al. 2000 Ghrelin strongly stimulates growth hormone release in humans. Journal of Clinical Endocrinology and Metabolism 85 49084911.
Tschöp M, Smiley DL & Heiman ML 2000 Ghrelin induces adiposity in rodents. Nature 407 908913.[CrossRef][Medline]
Volante M, Allìa E, Gugliotta P, Funaro A, Broglio F, Deghenghi R, Muccioli G, Ghigo E & Papotti M 2002 Expression of ghrelin and of the GH secretagogue receptor by pancreatic islet cells and related endocrine tumors. Journal of Clinical Endocrinology and Metabolism 87 13001308.
Wren AM, Seal LJ, Cohen MA, Brynes AE, Frost GS, Murphy KG, Dhillo WS, Ghatei MA & Bloom SR 2001 Ghrelin enhances appetite and increases food intake in humans. Journal of Clinical Endocrinology and Metabolism 86 5992.
Received in final form 28 February 2006
Accepted 4 April 2006
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |