|
|
||||||||
Department of Cancer Biology, The University of Texas M D Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030, USA
1 Department of Pathology, New York University School of Medicine, New York, New York 10010, USA
(Requests for offprints should be addressed to Z Wang; Email: zhenwang{at}mdanderson.org)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The prostate apoptosis response factor-4 (par-4) gene was originally identified by differential screening for genes that are up-regulated when prostate cells are induced to undergo apoptosis (Sells et al. 1994). Par-4 was subsequently found to possess potent apoptotic activity in various cellular systems in response to numerous stimuli (Mattson et al. 1999, Moscat & Diaz-Meco 2003, Gurumurthy & Rangnekar 2004). Part of this effect has been proposed to result from activation of the Fas/FasL-mediated apoptosis pathway (Chakraborty et al. 2001). More recently, functional and genetic analyses indicated that par-4 functions as a negative regulator of the protein kinase C-nuclear factor-
B (NF-
B)-X-linked inhibitor of apoptosis protein (XIAP) pathway (Garcia-Cao et al. 2003, Moscat & Diaz-Meco 2003). In addition, par-4 has also been identified as a transcription cofactor for the Wilms tumor suppressor gene (WT1) through direct interaction with the zinc-finger DBD of WT1 (Johnstone et al. 1996, Richard et al. 2001). Par-4 transcriptionally regulates bcl-2 gene expression through a WT1-binding site on the bcl-2 promoter (Boehrer et al. 2002, Cheema et al. 2003). The open-reading frame of human par-4 predicts a protein of 342 amino acids containing two putative nuclear localization signals at the N-terminus and a leucine zipper domain in the C-terminus region of the protein (El-Guendy & Rangnekar 2003). The C-terminal leucine zipper domain is necessary for homodimerization and heterodimerization with WT1 (Johnstone et al. 1996), protein kinase C (Diaz-Meco et al. 1996), Dlk (Kogel et al. 1998), and p62 (Dutta et al. 2001). Deletions of the leucine zipper domain abolishes its apoptotic activity (Sells et al. 1997, Guo et al. 1998), suggesting that the domain may play a significant role in par-4-mediated apoptosis. Recently, a unique core domain containing amino acid residues 137195 of par-4 was found to be essential and sufficient for induction of apoptosis in some cancer cells (El-Guendy et al. 2003).
In the present study, we found that par-4 directly interacted with the DBD of AR and increased AR-dependent transcription by enhancing AR-ARE interaction. We identified the c-FLIP gene as a target of par-4 and found that loss of c-FLIP expression was essential for castration-induced apoptosis in mouse prostate epithelial cells. These results suggest that AR and par-4 target the c-FLIP gene to control survival and apoptosis in the prostate gland.
| Materials and methods |
|---|
|
|
|---|
An expressed sequence tag cDNA clone (IMAGE 664597) encoding the full-length human par-4 gene was obtained from the American Type Culture Collection (Manassas, VA, USA). All par-4 cDNA fragments were amplified by PCR with specific oligonucleotides, cut with NdeI and BamHI, and subsequently cloned in the corresponding restriction sites of the vectors pET15d (Novagene, Madison, WI, USA), pGEX-2TL (Amersham Biosciences, Piscataway, NJ, USA), and pcDNA3.1 (Invitrogen, Carlsbad, CA, USA). The fragments were expressed as 6 His-tagged (via pET15d) or glutathione S transferase (GST)-fusion (via pGEX-2TL) proteins in Escherichia coli BL21 and purified through NTA Ni2+ agarose or glutathione Sepharose columns respectively. The cDNA encoding the c-FLIP short form was subcloned into pET15d, expressed, and purified through NTA Ni2+ agarose in a similar manner. Ten milligrams purified recombinant 6 His-par-4 and 6 His-c-FLIP (short form) were sent to Sigma Genosis (The Woodlands, TX, USA) for polyclonal antibody production. Anti-6 His-par-4 and anti-6 His-c-FLIP (short form) antibodies were purified through 6 His-par-4- and 6 His-c-FLIP (short form)-affinity columns respectively.
Establishment of prostate cell lines that stably expressed a FLAG-tagged par-4 and the N-terminal peptide of par-4
The mammalian expression vector, pBabe-f:par-4, was created by subcloning the FLAG-tagged human par-4 cDNA into the vector pBabe-Neo. The pBabe-internal ribosome entry site (IRES)-enhanced green fluorescent protein (EGFP) was constructed by subcloning the EcoRISalI fragment of the MSCV MIGR1 vector (Pear et al. 1998) into the EcoRI-SalI site of pBbabe-Neo. The cDNA encoding the N-terminal peptide (amino acid residues 136) of par-4 was subcloned into pBabe-IRES-EGFP to generate the pBabe-par-4(136)-IRES-EGFP construct. The prostate cancer cell line LNCaP was purchased from the American Type Culture Collection and maintained in RPMI 1640 medium plus 10% fetal bovine serum. Cells were transfected with pBabe-f:par-4, pBabe-IRES-EGFP, or pBabe-par-4(136)-IRES-EGFP and further incubated at 37 °C for 11.5 days before being split 1:6 for G418 selection (0.5 mg/ml). The medium was changed every 3 or 4 days. Individual G418-resistant colonies were expanded into cell lines and then characterized by western blotting using the anti-FLAG M2 monoclonal antibody (Sigma) for the FLAG-tagged par-4 cell lines or by observation of EGFP under a fluorescent microscope for EGFP and par-4(136)-IRES-EGFP cell lines. The positive cell lines were further expanded and analyzed. Nuclear and cytoplasmic extracts were prepared according to our standard methods (Wang & Roeder 1997) and used to immunopurify the par-4-containing complexes as previously described (Hosohata et al. 2003). Five microliter aliquots of the immunopurified complexes were mixed with equal volumes of 2x Laemmlis sample buffer and loaded onto a 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel. Proteins were visualized by silver staining.
Gel filtration chromatography and gel shift assay
Fifty microliters f:par-4 immunoprecipitate were loaded onto a Superose 6 column (3.2 x 300 mm; Smart System, Amersham Biosciences), and the column was eluted with BC3000.01% NP-40 at a flow rate of 40 µl/min. One hundred microliter fractions were collected. High-range gel filtration molecular weight markers (Amersham Biosciences) were separated on the same column under the same conditions. The gel shift assay was performed as previously described (Liu et al. 2003). In brief, the wild-type (ttgcAGAACAGCAAGT GCTagct) and mutant (ttgcAGAAtAGCAAaTGCT agct) ARE probes were derived from the prostate-specific antigen gene (152 to 174) and labeled with [
-32P]dCTP by a fill-in reaction with the Klenow enzyme. In gel shift assays, 20 µl reaction mixture contains 20 mM HEPES, pH 7.9, 70 mM KCl, 1 µg poly(dI-dC), 1 mM dithiothreitol, 0.1% NP-40, 100 µg/ml bovine serum albumin, and various proteins. The reaction mixture was incubated for 20 min at room temperature, and the binding reaction was initiated by the addition of the labeled probes (20 000 c.p.m.) and then incubated for an additional 30 min at room temperature. The reaction mixture was loaded directly onto a 4% (37.5:1, acrylamide:bisacrylamide) nondenaturing polyacrylamide gel with 0.25x Trisborate-EDTA and run at 150 V for 2 h at ambient temperature.
Cell culture and DNA transfection
PC3 cells were purchased from the American Type Culture Collection and cultured in RPMI 1640 medium containing 10% fetal bovine serum. Cells (5 x 104) were plated in each well of 24-well plates and transfected with 25 fmoles luciferase reporter plasmids, 0.8 fmoles control plasmid pRL-CMV, and 50 fmoles expression plasmids (balanced with the empty vector pcDNA3.1) using 1.5 µl Lipofectamine reagent (Invitrogen). Cells were grown in the presence or absence of ligands for 48 h after transfection and harvested for dual-luciferase activity assay (Promega, Madison, WI, USA).
Proteinprotein pull-down assay
GST and GST-par-4 variant proteins were expressed in bacteria and immobilized on glutathione Sepharose beads (Amersham Biosciences). Beads (10 µl) containing 1 µg GST or GST-par-4 variant proteins were incubated with 5 µl coupled transcription and translation (TNT) rabbit reticulocyte lysates containing 35S-labeled proteins in BC1500.1 NP-40 for 2 h at 4 °C. After being washed with the incubation buffer, beads were boiled with SDS sample buffer and subjected to SDS-polyacrylamide gel electrophoresis (PAGE), followed by autoradiography.
Northern blot analysis and chromatin immunoprecipitation
The northern blot and chromatin immunoprecipitation assays were performed as described (Gao et al. 2005). In brief, mRNAs were isolated from LNCaP cells cultured with phenol red-free RPMI 1640 supplemented with 10% charcoal/dextran-stripped fetal bovine serum for 2 days and then with or without 10 nM R1881 for 24 h. For northern blot analysis, 3 µg mRNA were fractionated with 1% denatured formaldehydeagarose gel, transferred to a Hybond N+ membrane (Amersham Biosciences), and cross-linked with ultraviolet light. The 771-bp fragment (7291499) of human c-FLIP cDNA (Gene Bank U97074
[GenBank]
) and human ß-actin cDNA were labeled with [
-32P]dCTP. Membranes were hybridized with probes at 65 °C overnight. After being washed to a final stringency of 0.1x SSC-0.1% sodium dodecyl sulfate (SDS) at 65 °C, the membrane was exposed to X-ray film. For chromatin immunoprecipitation, LNCaP cells were grown in phenol red-free RPMI 1640 supplemented with 10% charcoal/dextran-stripped fetal bovine serum for 3 days and then treated with 10 nM R1881 for 36 h. Cells treated with ethanol were used as the control. Chromatin immunoprecipitation was performed with 2 µg antigen-purified anti-par-4 antibody. Immunopurified DNA was used for a PCR reaction (30 cycles, annealing at 50 °C), with the following primers: for c-FLIP, the forward primer sequence was GATCACGAGGTCAAGAGTTC and the reverse primer sequence was GACACAAGTTCC ACGCGTTAG, which amplifies a 290-bp product from 321 to 32 upstream of the c-FLIP gene; for ß-actin, the forward primer sequence was TCCTCCTCTTC CTCAATCTCG and the reverse primer sequence was AAGGCAA CTTTCGGAACGG, which amplifies a 145-bp product from 1118 to 974 of the ß-actin gene (the A of the ATG translation start codon was arbitrarily given the number +1).
Castration-induced apoptosis in the prostate gland
Twenty male C57BL/6J mice (2 months old) were purchased from The Jackson Laboratory (Bar Harbor, ME, USA) and treated in accordance with the approved protocol of the Institutional Animal Care and Use Committee. Mice were castrated or sham-operated under anesthesia. At each of 2, 7, 15, and 30 days after surgery, prostate glands were dissected, fixed in 10% formalin overnight, and embedded in paraffin. Paraffin sections (5 µm thick) were cut and mounted on glass slides. After being de-waxed, slides were stained with 0.1% Hills hematoxylin #3 and eosin (H&E) or used for immunohistochemical staining or in a terminal deoxynucleotidyl transferase-mediated dUPT nick-end labeling (TUNEL) assay.
Western blot and immunohistochemical staining
Whole-cell lysates were electrophoresed on SDS-PAGE and then transferred to a nitrocellulose membrane for Western blot analysis. Blots were incubated with anti-AR (1:5000), anti-par-4 (1:5000), anti-c-FLIP (1:5000), or anti-FLAG (1:1000) (Sigma) antibody for 2 h at room temperature and then incubated for 1.5 h with the peroxidase-conjugated second antibody (1:5000) (Amersham Biosciences). The protein bands were detected by an enhanced chemiluminesence kit (Amersham Biosciences).
The slides were incubated with 3% bovine serum albumin for 30 min and then incubated with the anti-AR (1:50), anti-par-4 (1:100), or anti-c-FLIP (1:50) antibody overnight at 4 °C. A streptavidin-biotin peroxidase detection system was used according to the manufacturers instructions (DAKO, Carpinteria, CA, USA). After being washed with PBS, slides were developed with stable 3,3'-diaminobenzidine and counterstained with H&E.
Apoptosis assays
Flow cytometry was used to assess the sub-G1 DNA population of cells undergoing apoptosis. Cells were released from plates and fixed with 70% ethanol overnight. Analysis of the sub-G1 DNA content was performed on a flow cytometer (EPICS XL-MCL, Beckman Coulter, Miami, FL, USA) according to the manufacturers protocol with propidium iodide (50 µg/ml) staining. The TUNEL assay was performed with the paraffin sections of LNCaP cells and mouse prostate using the apoptosis detection kit (Promega) according to the manufacturers instructions. For double staining, slides were first immunostained with anti-c-FLIP antibody with Alexa Fluor 594-conjugated secondary antibody (Molecular Probes, Eugene, OR, USA) and then submitted for the TUNEL assay. The signals were observed under a fluorescent microscope with a red (for c-FLIP staining) or a green (for TUNEL assay) filter. The apoptotic cells were quantified as follows: slides were evaluated under a microscope (Olympus IX71) with a digital camera (Retiga 1300) that was interfaced to a computer with PCI software (Compix Inc., Cranberry Township, PA, USA). The number of epithelial cells of the area of prostate on the image was counted. There were about 300 to 500 cells per area, and three areas were captured on each slide. The fluorescence-labeled cells (apoptotic cells) from the same area of the prostate were captured and counted. Two prostate glands derived from two mice per experimental group were analyzed.
Prostate tissue specimens and pathological evaluation
For in situ hybridization of par-4 and c-Flip, prostate cancer and normal control tissues were retrieved from archival radical prostatectomy specimens of 44 patients with prostate cancer who had been treated at New York University Medical Centers. In addition, a prostate cancer tissue microarray with hormone naive and resistant cases was constructed and used for immunohistochemistry of c-Flip. Hormone resistant samples were derived from patients who underwent channel transurethral resection (TURP) at least 6 months after surgical prostatectomy. Hormone naive cases were derived from TURP and radical prostatectomy specimens of patients with prostate cancer. Hormone naive TURP specimens were derived from patients who were diagnosed with prostate cancer by TURP, having high grade (Gleason 8 or higher) and volume of disease. A separate group of radical prostatectomy that had previously undergone neoadjuvant therapy (Meyer et al. 1999, Powell et al. 2002) for 3 months prior to radical prostatectomy was also added to the prostate cancer tissue microarray as a neoadjuvant group. Due to the heterogeneous nature of prostate cancer, each case is represented by four 0.6 mm cores. The study protocol was approved by the New York University institution review board. Clinical samples were fixed in 10% neutral buffered formalin for 624 h and embedded in paraffin. Sections of the tissue (4 µm) were cut and mounted on Super-frost Plus adhesion slides (Fisher Scientific Company, Pittsburg, PA, USA) and used for histological analysis, in situ hybridization and immunohistochemistry. The histological features of each individual specimen were confirmed independently by two urology pathologists (P L and J M).
For in situ hybridization, the DNA fragment of the corresponding par-4 and c-Flip cDNA coding region was subcloned into pBluescript II, and the digoxigenin-labeled RNA probes were synthesized by incubation of DNA with T7 or T3 RNA polymerase. After wax removal and rehydration, 4-µ sections of formalin-fixed tissue were hybridized with the digoxigenin-labeled RNA probes, washed and developed by incubation with chromogenic substrate (positive cells stain purple or blue, and negative cells stain colorless or light pink).
Immunohistochemistry was performed on prostate cancer tissue microarray with the anti-c-Flip antibody at 1:50 dilution after antigen retrieval (20 min) in a microwave in citrus buffer (pH 6.0). The staining intensity is scored semi-quantitatively as 1+ for weak staining, 2+ for moderate staining, and 3+ strong staining. The scores were assigned to each core by consensus review of two pathologists.
| Results |
|---|
|
|
|---|
Castration decreased AR expression in androgen-dependent cells of the prostate gland and, at the same time, induced par-4 expression (Sells et al. 1994). Yeast two-hybrid screening with WT1 as bait identified par-4 as a WT1-interacting protein, which modulated the transcriptional activity of WT1 (Johnstone et al. 1996, Richard et al. 2001). On the basis of these observations, we postulated that par-4 might function as a coactivator for AR to compensate for loss of AR function due to androgen depletion by castration. To test this hypothesis, transfection experiments were carried out to analyze the effects of par-4 on transcriptional activation driven by AR. A luciferase reporter (4 xARE-E4-luc) was co-transfected with expression vectors for AR, par-4, or both into PC3 cells in the absence or presence of the synthetic androgen (R1881). As shown in Fig. 1A
, AR activated the reporter gene by about sixfold in the presence of R1881, and coexpressed par-4 showed a 5.6-fold enhancement of this activity. Par-4 did not influence reporter gene activity in the absence of R1881, indicating that the enhancing effect of par-4 on AR-dependent gene expression was androgen dependent. Par-4 also enhanced the AR-driven transcription from natural probasin (244 to +12) (Claessens et al. 1996) and the prostate-specific androgen (PSA) enhancer (4354 to 3858) (Schuur et al. 1996) reporter constructs in an androgen-dependent manner (Fig. 1A
).
|
), glucocorticoid receptor (GR), progesterone receptor (PRß), and thyroid hormone receptor (TR
). Par-4 also enhanced ER
-, GR-, and PRß-driven gene expression; in contrast, par-4 showed no effect on TR
-mediated transcription (data not shown). Hence, par-4 enhanced the steroid hormone receptor-dependent transcription in vivo. Par-4 exists as an octamer in HeLa cells
The 6 His-tagged par-4 was expressed and purified from bacteria and had an apparent molecular mass of 44 kDa, as determined by SDS-PAGE (Fig. 2A
). It has been shown that par-4 interacts with itself through the C-terminal leucine zipper domain (Dutta et al. 2001). To characterize the molecular properties of par-4 in vivo, we generated a stable cell line expressing FLAG epitope-tagged par-4. Immunopurification of f:par-4 from nuclear extracts made from f:par-4 cells revealed the association of a 44-kDa polypeptide with f:par-4 (Fig. 2B
, lanes 3 and 4, indicated by a white arrow). The specific association of this polypeptide with f:par-4 is further demonstrated by the failure of similar-sized polypeptides in extracts from control cells (not expressing f:par-4) to bind to the affinity matrix (lane 2). Close examination of the silver-stained gel did not reveal any other polypeptides associated with f:par-4 (Fig. 2B
, lane 3 versus lane 2). The band (Fig. 2B
, lanes 3 and 4, indicated by a star on the right) was a degraded product of par-4 because it was recognized by anti-par-4 antibody (Fig. 2D
, indicated by a star on the left). Western blot analysis with anti-par-4 antibody demonstrated that the f:par-4 associated 44-kDa polypeptide in the immunoprecipitate was the endogenous par-4 (Fig. 2C
, lane 6). The f:par-4 also associated with endogenous par-4 in the cytoplasm (Fig. 2C
, lane 4).
|
The N-terminal peptide of par-4 functions as a dominant negative
The par-4 protein is highly conserved during evolution throughout the entire coding region. The N-terminal (amino acid residues 136), middle (amino acid residues 135201), and C-terminal (269342) parts of par-4 are the most conserved (Fig. 3B
). The C-terminal part contains a leucine zipper (amino acid residues 301342). On the basis of these structural features, we generated a set of deletions (Fig. 3B
). The deletion variants of par-4 were subcloned into the mammalian expression vector (pcDNA3.1) and transiently transfected into PC3 cells (Fig. 3A
). Western blot analysis revealed that expression of these truncation constructs occurred at similar levels (data not shown). Deletion of up to the first 145 amino acid residues from the N-terminal did not apparently affect the ability to enhance AR-transactivation. However, further deletion from the N-terminal completely abolished the ability of par-4 to increase AR-dependent transcription. The deletion of the C-terminal up to amino acid residue 201 did not affect par-4-induced luciferase activity, but further deletion resulted in complete loss of par-4-induced luciferase activity. Thus, the central domain (amino acid residues 146201) of par-4 is important for the enhancement of AR-dependent transactivation. The N-terminal peptide (amino acid residues 136) of par-4 functioned as a dominant negative, indicating that endogenous par-4 contributed to the observed AR-dependent transcription in PC3 cells.
|
Next, using an in vitro transcription and translation system, we produced a series of [35S]methionine-labeled par-4 deletion variants. These variants were incubated with GST-par-4 immobilized on glutathione Sepharose beads. After incubation, the beads were washed extensively. The bound 35S-par-4 variants were then analyzed by SDS-PAGE and autoradiography (Fig. 4A
). As a negative control for nonspecific binding, GST-glutathione Sepharose beads were incubated with 35S-par-4 variants at the same time under the same conditions. The full-length 35S-par-4 (Fig. 4A
, lanes 13) failed to associate with GST-beads (lane 2) but was retained on the par-4-beads (lane 3). 35S-par-4 variants lacking the C-terminal 74-amino acid residues weakly interacted with par-4 beads (Fig. 4A
, lanes 2224), indicating a requirement of this region (leucine zipper domain) for binding. In contrast, all 35S-par-4 deletion variants possessing the C-terminal 141 amino acid residues bound to GST-par-4 beads (Fig. 4A
, lanes 6, 9, 12, and 15), revealing that this region is necessary and sufficient for interaction. However, the 35S-par-4 variant with 36 amino acid residues deleted from the N-terminal bound to GST-par-4 beads with much higher affinity (Fig. 4A
, lane 9 versus lane 3), indicating that the N-terminal 36 amino acid residues inhibited the interaction between par-4 and itself. It was interesting that 35S-labeled par-4 (269342) was retained on the GST-par-4 (136) beads (Fig. 4B
, lanes 13), suggesting that there is an intermolecular interaction within the par-4 molecule. This intermolecular interaction required the intact dimerization domain (amino acid residues 269342) (Fig. 4B
, lanes 49). Under the same conditions, the N-terminal part (amino acid residues 1136) did not show any intermolecular interaction (Fig. 4B
, lanes 1921).
|
Par-4 enhanced AR-ARE interaction
After demonstrating that the DBD of AR mediates the interactions of AR with par-4, we investigated whether par-4 affects ARARE interaction. A DNA probe containing the ARE derived from the PSA promoter (152 to 174) (Cleutjens et al. 1996) was used for a gel shift assay (Fig. 5
). Par-4 (1301) (Fig. 5A
, lane 2) and the DBD of AR (amino acid residues 537 to 644) (Liu et al. 2003) were expressed as a 6 His-tagged fusion protein and purified through an NTA Ni2+ agarose affinity column. The recombinant DBD shifted the probe (Fig. 5B
, lanes 2 and 7), and addition of the recombinant par-4 (1301) (lanes 35), not BSA (lanes 810), enhanced DBDARE complex formation in a dose-dependent manner. Mutations on the conserved nucleotides in the ARE abolished DBDARE complex formation (lanes 1214), indicating that the par-4-mediated enhancement of the ARARE interaction was dependent on functional ARE. The addition of par-4 did not change the migration of DBDARE, suggesting that par-4 was not in the DBDARE complex in the gel. This may reflect instability of the tentative complex of par-4ARARE in the electrophoresis assay. A similar phenomenon was observed in another study when the thyroid hormone receptor/TR-associated proein (TR/TRAP) and TATA-box binding protein/TBP-associated factors (TBP/TAFs) complexes interacted with their cognate DNA elements in a gel shift assay (Fondell et al. 1996). Similarly, par-4 (1301) also dramatically increased the density of the ARARE band (up to 10-fold) (Fig. 5C
, lanes 35 versus lane 2). Under the same conditions, we did not observe any interaction between par-4 and the DNA probe (data not shown). The same assay was performed with the full-length par-4 expressed in and purified from bacteria and results were not conclusive due the aggregation/polymerization of par-4 protein (data not shown). These results indicate that enhanced AR transactivation by par-4 may occur through the increased binding affinity of AR to the ARE in the presence of par-4.
|
We tried to fuse the FLAG epitope at the N- or C-terminal end of the N-terminal amino acid residues 136 (N-terminal peptide) of par-4 to detect its expression in cells, but the FLAG epitope tag abolished the dominant negative function of the N-terminal peptide (data not shown). To overcome this obstacle, we constructed an expression vector (Fig. 6A
). This vector included an internal ribosomal entry site (IRES) and expressed one mRNA that encodes the N-terminal peptide of par-4 and EGFP. Therefore, the presence of EGFP indicated that the N-terminal peptide of par-4 was expressed (Fig. 6B
). LNCaP cells were transfected with this construct, and the stable cell lines were obtained by G418 selection. One control line (transfected with the empty vector and expressing EGFP only) (Fig. 6B
, panel a) and two positive lines (#1 and #6) (panels b and c) with the moderate EGFP signals were chosen for further analysis. We evaluated the effect of N-terminal peptide expression on apoptosis in LNCaP cells by flow cytometry. A low percentage (1.6%) of EGFP-LNCaP cells were apoptotic (Fig. 6C
, panel a), whereas par-4(136)-LNCaP cells showed much higher percentages (#1: 10.9% and #6: 16.1%) of cell death (Fig. 6C
, panels b and c). Similarly, the TUNEL assay (Fig. 6D
) revealed that very few apoptotic cells (0.5 ± 0.3%) were detectable in the EGRP-LNCaP cell line (panel a). However, more apoptotic cells (#1: 6.5 ± 2.2% and #6: 7.3 ± 2.6%) were found in par-4(136)-LNCaP cell lines (panels b and c, indicated by white arrows). These results suggest that expression of the N-terminal peptide of par-4 induced apoptosis in LNCaP cells.
|
In a previous study, par-4-induced apoptosis of the AR-negative prostate cancer cells (PC3, DU-145, and TSU-Pr) correlated with trafficking of Fas/FasL to the cell membrane, indicating that activation of the Fas/FasL apoptotic pathway by par-4 may play an important role in par-4-induced apoptosis (Chakraborty et al. 2001). In contrast, par-4 did not induce apoptosis in the AR-positive epithelial cells (LNCaP and normal prostate epithelial cells). On the basis of our observations that par-4 is a coactivator of AR and that AR inhibits par-4-induced apoptosis in PC3 cells (data not shown), we hypothesize that par-4 plus AR activates transcription of genes whose function is to suppress Fas/FasL-mediated apoptosis. One candidate, c-FLIP, was found to prevent Fas/FasL-mediated apoptosis by inhibiting caspase-8 activation at the death-inducing signaling complex (Chang et al. 2002), and we recently reported that AR directly targets the c-FLIP gene (Gao et al. 2005). Western blot analysis revealed that the c-FLIP protein levels in cell lines expressing the N-terminal peptide of par-4 were lower than those in the control cell line (Fig. 7A
, top panel, lanes 2 and 3 versus lane 1). In contrast, the levels of ß-actin were not affected by expression of the N-terminal peptide of par-4 (Fig. 7A
, bottom panel). Northern blot analysis demonstrated that the androgen up-regulated c-FLIP mRNA about twofold (Fig. 7B
, top two panels, lane 2 versus lane 1). Expression of the N-terminal peptide of par-4 inhibited the androgen-induced expression of the c-FLIP gene to 1.2-fold (lane 4 versus lane 3) and 1.1-fold (lane 6 versus lane 5) for the cell line #1 and #6 respectively. These observations indicate that as a cofactor of AR, par-4 targets the c-FLIP gene. Transient transfection of the c-FLIP reporter plasmid into PC3 cells in the presence of AR approximately doubled luciferase activity over that measured in the absence of AR, and co-expressed par-4 further enhanced this activity (Fig. 7C
). Three functional AREs were identified within the c-FLIP gene (Gao et al. 2005). Par-4 did not influence ARE1,2-mutated (C61T, G67A, C95T, G101A) c-FLIP reporter gene activity, indicating that the enhancing effect of par-4 on c-FLIP gene expression was AR-dependent (Fig. 7C
). We previously demonstrated that AR bound to the c-FLIP promoter regions in the presence of androgen by chromatin immunoprecipitation assay (Gao et al. 2005). The chromatin immunoprecipitation assay also showed the androgen-dependent recruitment of par-4 onto the c-FLIP promoter (Fig. 7D
, lane 4 versus lane 3). The products amplified by PCR at the same time from the ß-actin promoter, which served as negative controls, were not changed in response to the addition of androgen (Fig. 7D
, lanes 1 and 2). These results indicate that par-4 with AR directly targets the c-FLIP promoter to enhance its gene expression in response to androgens. Thus, apoptosis induced by expression of the N-terminal peptide of par-4 in LNCaP cells might result from the down-regulation of c-FLIP gene expression. Consistent with this conclusion, we observed that only the c-FLIP negative cells underwent apoptosis in the par-4(136)-LNCaP cell line (Fig. 6D
, panel d).
|
The cell death that occurs in the prostate gland after castration is one of the typical apoptosis models for studying the morphological and biochemical events involved in apoptosis (Evans-Storms & Cidlowski 1995). Although the natural features of castration-induced apoptotic prostate cells have been well documented (Hu et al. 1998), the mechanism of castration-induced prostate cell death has not been well defined. In order to investigate the role of AR, par-4, and c-FLIP in the castration-induced apoptosis in mouse prostate, castrated male mice were killed at each of 2, 7, 15, and 30 days after operation. The prostate glands gradually changed from well-branched to small and un-branched and were tightly surrounded by several layers of stromal cells (Fig. 8A
, top panels a-e). The AR protein levels began to drop 2 days after castration and were very low 7 days after surgery (Fig. 8A
, f-j). The par-4 protein stained strongly in the nucleus and weakly in the cytoplasm in epithelial cells, and its levels were induced 2 days after castration (Fig. 8A
, panel l) and remained at high levels (panels m-o). Strong c-FLIP signals were detected in the nucleus of the epithelial cells (Fig. 8A
, panels p-t). A few (4.3% ± 1.3) c-FLIP-negative epithelial cells appeared 2 days after castration (Fig. 8A
, panel q, indicated by white arrows). Seven days after castration, the number of c-FLIP-negative cells increased substantially (11% ± 2.3) (Fig. 8A
, panel r, indicated by white arrows). The number of c-FLIP negative cells then gradually decreased, reaching basal levels 30 days after castration, and strong c-FLIP signals were then detected in nearly all epithelial cells (Fig. 8A
, panel t). The castration-induced apoptotic cells were detected by the TUNEL assay. In control mice, a few apoptotic cells (0.15% ± 0.08) were found (Fig. 8A
, panel u). The number of apoptotic cells (0.57% ± 0.09) had increased above the control cells 2 days after castration (panel v, indicated by a white arrow), and a large number (1.56% ± 0.26) was present on the seventh day (panel w, indicated by white arrows). Thirty days after castration, the level of apoptotic cells (0.13% ± 0.06) was the same as the level of control cells (Fig. 8A
, panel y). We performed anti-c-FLIP immunostaining (red) and the TUNEL assay (blue) with the same slides and found that only the c-FLIP-negative cells (indicated by a white arrow) had undergone apoptosis (Fig. 8A
, panel w, insert). These results suggest that loss of c-FLIP expression is essential for castration-induced apoptosis. In total, our results indicate that the AR-par-4 pathway controls survival and apoptosis in the prostate gland through regulation of c-FLIP gene expression. The nuclear and cytoplasmic localization of c-FLIP in the prostate epithelial cells was further demonstrated by immunofluorescent staining with anti-c-FLIP antibody and by nuclear staining with DAPI (Fig. 8A
, bottom panels). The presence of the antigen (c-FLIPs) dramatically decreased the immunostaining signals (Fig. 8A
, bottom right panel), indicating the specificity of immunohistochemical analysis.
|
Recent studies indicated that par-4 had tumor-suppression activity in mouse prostate gland and its expression was down-regulated in some cancer tissues (Cook et al. 1999, Kogel et al. 2001, Boehrer et al. 2002, Garcia-Cao et al. 2005). To see whether par-4 plays any role in human prostate tumorigenesis, we evaluated the expression of par-4, in correlation with c-Flip expression, in 44 prostate cancer tissues derived from archival prostectomy specimens by in situ hybridization analysis and found that 21 patients with prostate cancer (48%) had elevated par-4 expression in cancer tissues compared with the adjacent benign prostate tissues (Fig. 9A
). Five cases (11%) showed lower expression of par-4 in tumors compared with adjacent benign tissues. Eighteen cases (41%) showed no obvious change in par-4 expression. It has been shown that par-4 expression is induced by various stresses (El-Guendy & Rangnekar 2003). The observed par-4 over-expression may have resulted from stresses such as hypoxic environment in the prostate cancer tissues. In the same specimens, 22 of 44 (50%) of cases showed increased expression levels for c-FLIP in cancer tissues. Among the 48% of cases in which par-4 was over-expressed, 67% of cases also showed c-FLIP over-expression. On the basis of our observations, these results suggest that up-regulation of c-FLIP expression might result from up-regulation of par-4 expression. Because the NF-
B signaling pathway also up-regulates c-FLIP gene expression (Micheau et al. 2001), other signals might be responsible for c-FLIP over-expression in the other prostate cancer cases.
|
| Discussion |
|---|
|
|
|---|
The structure and functions of par-4
Par-4 has a leucine zipper domain that spans the region between amino acid residues 301 and 342 (Dutta et al. 2001). The leucine zipper structure is packed together in a parallel
-helix with the conserved leucine residues located on one side of each helix (Johnson & McKnight 1989). The leucine zipper domain has been found in many transcription factors, including myc, fos, and jun, and is essential for the formation of homodimeric and heterodimeric complexes. Consistent with previous observations (Sells et al. 1994, Nessler-Menardi et al. 2000, Moscat & Diaz-Meco 2003, Culig et al. 2004), we found that deletion of the C-terminal part (amino acid residues 269342) dramatically decreased par-4's interaction with itself, and that the C-terminal parts (amino acid residues 137342 and 201342) strongly interacted with themselves. The regions outside the C-terminal part (amino acid residues 269342) also contributed to par-4's interaction with itself, but to a much lesser extent. In contrast to its function in apoptosis, the C-terminal leucine zipper region (amino acid 202342) of par-4 was not required for its cofactor, AR-dependent, transcription function. These results suggest that par-4's cofactor activity can be separated from its ability to stimulate apoptosis.
Intermolecular interaction plays important roles in regulating the functions of various transcription factors (Hupp et al. 1995, Jayaraman & Prives 1995, Liu et al. 1998, Liu et al. 2003). We found a novel interaction between the N-terminal part (amino acid residues 136) and the C-terminal part (amino acid residues 269342) of par-4. This interaction strongly inhibited par-4's interaction with itself and with AR. The intermolecular interaction was not apparently required for the par-4-mediated enhancement of AR-driven gene expression because deletion of amino acid residues 136 or 269342 had no effect. It is not known whether the intermolecular interaction is involved in par-4-mediated apoptosis. The N-terminal peptide of par-4 did not interact with AR, and deletion of amino acid residues 136 from par-4 did not affect the par-4-mediated enhancement of AR-driven transcription, but strongly interacted with the C-terminal 270 amino acid residues. On the basis of these observations, we believe that the dominant-negative effect of the N-terminal peptide of par-4 is mediated through its interaction with the C-terminal part of par-4.
Par-4 functions as a new cofactor for AR
More than 10 factors have been shown to interact with the DBD of AR and to modulate AR-driven transcription (ww2.mcgill.ca/androgendb/ARinteract.pdf). The molecular mechanisms of the action of these factors on AR-driven gene expression are largely unknown. Some factors, such as prostate epithelium-specific ETS transcription factor (PDEF) (Oettgen et al. 2000) and octamer binding transcription factor (OCT)-1/2 (Prefontaine et al. 1999, Gonzalez & Robins 2001), have sequence-specific DNA-binding activity and might synergistically interact with DNA in the presence of AR. It was also reported that c-jun interacted with the DBD of AR and inhibited ARARE interaction (Sato et al. 1997). Our finding that the DBD of AR (containing two zinc fingers) mediates its interaction with par-4 is reminiscent of the WT1par-4 interaction previously reported (Johnstone et al. 1996). In that study, the four zinc fingers of WT1 were shown to interact with par-4. This par-4WT1 interaction plays a role in par-4-mediated repression of transcription of WT1. It thus appears that par-4 may interact with a number of cellular proteins via their zinc finger-containing domains. Consistent with this conclusion, we observed that par-4 enhanced estrogen receptor
-, glucocorticoid receptor-, and progesterone receptor ß-driven gene expression (data not shown). Par-4 was shown to repress reporter gene expression when tethered to DNA via the GAL4 DNA-binding domain, suggesting that it has the repression domain (Johnstone et al. 1996, Babichev et al. 2001). It was also demonstrated that transactivation of the alternative splicing isoform of WT1 was dependent on a specific interaction with par-4, and a mutation in WT1 found in Wilms tumor disturbs this interaction and the function of the activation of WT1 (Richard et al. 2001). Induced par-4 expression was strongly correlated with the ability of WT1 to regulate cell survival and proliferation. Thus, the functions of par-4 as coactivator or co-repressor might depend on its interacting protein partners, cell type, the promoter context, or some combination of these. The mechanisms that control the activation and repression functions of par-4 have yet to be fully elucidated. Our observations suggest that the par-4-mediated enhancement of AR (possibly the WT1 isoform) transaction might occur through an increase in ARARE interaction.
AR and par-4 target c-FLIP gene expression to control apoptosis in the prostate gland
We previously demonstrated that the AR pathway directly targets the c-FLIP gene, and we identified three functional AREs in the c-FLIP promoter (Gao et al. 2005). Here, we showed that par-4 functions as an AR cofactor for androgen-driven c-FLIP gene expression. This conclusion was supported by the following three experiments. First, we observed that par-4 enhanced androgen-driven c-FLIP promoter activity in the transient trasnfection assay. Secondly, chromatin immunoprecipitation analysis indicated that par-4 directly bound to the promoter region of the c-FLIP gene in response to the androgen treatment, suggesting that it directly targeted the c-FLIP gene. Thirdly, expression of the dominant-negative par-4 inhibited c-FLIP gene expression.
The androgen pathway exerts a protective effect in the prostate gland (Hakimi et al. 1996) and in androgen-sensitive human prostate cancer LNCaP cells (Coffey et al. 2002). Although the mechanisms underlying these effects have not been clearly defined, androgens effects on both proapoptotic and anti-apoptotic gene expression have been demonstrated (Coffey et al. 2002). We observed that AR levels gradually decreased in all epithelial cells following castration and reached the lowest level 7 days after castration. In contrast, par-4 levels increased simultaneously in all epithelial cells after castration and then stayed at high levels. It was surprising that a few epithelial cells lost c-FLIP expression following castration. Most interestingly and significantly, apoptosis was only detected in the epithelial cells that did not express c-FLIP. Transcription is traditionally considered as a graded process with promoter activity changing proportionally in response to various signals. The expression of the AR gene in response to castration is compatible with this model. But, recent work on the nature of enhancer action suggests a binary model of transcription control (Fiering et al. 2000). The binary model implies that enhancers act in a stochastic fashion to increase the probability that a regulated gene will be transcribed. This model would predict a non-uniform reduction in c-FLIP gene expression, with castration resulting in a decreased fraction of cells that express c-FLIP gene (at or near wild-type levels) relative to the fraction of cells that do not express c-FLIP gene at all. Thus, castration-induced apoptosis could go on continuously in individual cells at various times by controlling c-FLIP expression. Thirty days after castration, the c-FLIP levels were very high in all epithelial cells and then apoptosis largely ceased, although par-4 levels were very high. These results suggest that expression of the c-FLIP gene is not solely controlled by the androgen pathway but also by other signals such as the NF-
B pathway (Micheau et al. 2001). The combination of the AR pathway and these signals might determine the levels of c-FLIP in prostate epithelial cells.
It is well documented that c-FLIP functions as a potent inhibitor of the Fas/FasL-induced apoptosis and that par-4 induces apoptosis. Our present data provide a framework to understand how androgen can determine survival and apoptosis in the prostate gland (Fig. 8B
). Specifically, in the presence of androgens, both AR and par-4 act as transcriptional activators or co-activators for the expression of genes whose protein inhibits apoptosis (such as c-FLIP) or promotes cell survival. However, in the absence of androgens (such as after castration), c-FLIP expression is lost, and par-4 induces apoptosis by activation of Fas/FasL-mediated apoptosis. This model also explains why ectopic expression of par-4 induced apoptosis of AR-negative prostate cancer cells but not of AR-positive prostate cancer and normal prostate epithelial cells (Chakraborty et al. 2001). On the basis of our observations, we speculate that the androgen-independent expression of the c-FLIP gene would contribute to the androgen-independent growth of prostate cancer cells. Consistent with this possibility, we observed enhanced c-FLIP expression in the androgen-resistant prostate cancer and over-expression of the c-FLIP gene enhanced the androgen-independent growth of LNCaP xenographs in nude mice (Gao et al. 2005). Given that par-4 plays a role in enhancing apoptosis in response to various stimuli and functions as a novel transcriptional cofactor of AR, the study of par-4 regulation mechanisms will help us to understand par-4's roles in cancer and neuronal diseases.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Bentel JM & Tilley WD 1996 Androgen receptors in prostate cancer. Journal of Endocrinology 151 111.
Boehrer S, Chow KU, Beske F, Kukoc-Zivojnov N, Puccetti E, Ruthardt M, Baum C, Rangnekar VM, Hoelzer D, Mitrou PS et al. 2002 In lymphatic cells par-4 sensitizes to apoptosis by down-regulating bcl-2 and promoting disruption of mitochondrial membrane potential and caspase activation. Cancer Research 62 17681775.
Brinkmann AO, Blok LJ, de Ruiter PE, Doesburg P, Steketee K, Berrevoets CA & Trapman J 1999 Mechanisms of androgen receptor activation and function. Journal of Steroid Biochemistry and Molecular Biology 69 307313.[CrossRef][Web of Science][Medline]
Chakraborty M, Qiu SG, Vasudevan KM & Rangnekar VM 2001 Par-4 drives trafficking and activation of Fas and Fasl to induce prostate cancer cell apoptosis and tumor regression. Cancer Research 61 72557263.
Chang DW, Xing Z, Pan Y, Algeciras-Schimnich A, Barnhart BC, Yaish-Ohad S, Peter ME & Yang X 2002 c-FLIP(L) is a dual function regulator for caspase-8 activation and CD95-mediated apoptosis. EMBO Journal 21 37043714.[CrossRef][Web of Science][Medline]
Cheema SK, Mishra SK, Rangnekar VM, Tari AM, Kumar R & Lopez-Berestein G 2003 Par-4 transcriptionally regulates Bcl-2 through a WT1-binding site on the bcl-2 promoter. Journal of Biological Chemistry 278 1999520005.
Claessens F, Alen P, Devos A, Peeters B, Verhoeven G & Rombauts W 1996 The androgen-specific probasin response element 2 interacts differentially with androgen and glucocorticoid receptors. Journal of Biological Chemistry 271 1901319016.
Cleutjens KB, van Eekelen CC, van der Korput HA, Brinkmann AO & Trapman J 1996 Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter. Journal of Biological Chemistry 271 63796388.
Coffey RN, Watson RW, ONeill AJ, McEleny K & Fitzpatrick JM 2002 Androgen-mediated resistance to apoptosis. Prostate 53 300309.[CrossRef][Web of Science][Medline]
Cook J, Krishnan S, Ananth S, Sells SF, Shi Y, Walther MM, Linehan WM, Sukhatme VP, Weinstein MH & Rangnekar VM 1999 Decreased expression of the pro-apoptotic protein Par-4 in renal cell carcinoma. Oncogene 18 12051208.[CrossRef][Web of Science][Medline]
Craft N, Chor C, Tran C, Belldegrun A, DeKernion J, Witte ON, Said J, Reiter RE & Sawyers CL 1999 Evidence for clonal outgrowth of androgen-independent prostate cancer cells from androgen-dependent tumors through a two-step process. Cancer Research 59 50305036.
Culig Z, Comuzzi B, Steiner H, Bartsch G & Hobisch A 2004 Expression and function of androgen receptor coactivators in prostate cancer. Journal of Steroid Biochemistry and Molecular Biology 92 265271.[CrossRef][Web of Science][Medline]
Denmeade SR, Lin XS & Isaacs JT 1996 Role of programmed (apoptotic) cell death during the progression and therapy for prostate cancer. Prostate 28 251265.[CrossRef][Web of Science][Medline]
Diaz-Meco MT, Municio MM, Frutos S, Sanchez P, Lozano J, Sanz L & Moscat J 1996 The product of par-4, a gene induced during apoptosis, interacts selectively with the atypical isoforms of protein kinase C. Cell 86 777786.[CrossRef][Web of Science][Medline]
Dutta K, Alexandrov A, Huang H & Pascal SM 2001 pH-induced folding of an apoptotic coiled coil. Protein Science 10 25312540.[CrossRef][Web of Science][Medline]
El-Guendy N & Rangnekar VM 2003 Apoptosis by Par-4 in cancer and neurodegenerative diseases. Experimental Cell Research 283 5166.[CrossRef][Web of Science][Medline]
El-Guendy N, Zhao Y, Gurumurthy S, Burikhanov R & Rangnekar VM 2003 Identification of a unique core domain of par-4 sufficient for selective apoptosis induction in cancer cells. Molecular and Cellular Biology 23 55165525.
Evans-Storms RB & Cidlowski JA 1995 Regulation of apoptosis by steroid hormones. Journal of Steroid Biochemistry and Molecular Biology 53 18.[CrossRef][Web of Science][Medline]
Fiering S, Whitelaw E & Martin DI 2000 To be or not to be active: the stochastic nature of enhancer action. Bioessays 22 381387.[CrossRef][Web of Science][Medline]
Fondell JD, Ge H & Roeder RG 1996 Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex. PNAS 93 83298333.
Gao S, Lee P, Wang H, Gerald W, Adler M, Zhang L, Wang YF & Wang Z 2005 The androgen receptor directly targets the cellular Fas/FasL-associated death domain protein-like inhibitory protein gene to promote the androgen-independent growth of prostate cancer cells. Journal of Molecular Endocrinology 19 17921802.[CrossRef]
Garcia-Cao I, Lafuente MJ, Criado LM, Diaz-Meco MT, Serrano M & Moscat J 2003 Genetic inactivation of Par4 results in hyperactivation of NF-kappaB and impairment of JNK and p38. EMBO Reports 4 307312.[CrossRef][Web of Science][Medline]
Garcia-Cao I, Duran A, Collado M, Carrascosa MJ, Martin-Caballero J, Flores JM, Diaz-Meco MT, Moscat J & Serrano M 2005 Tumour-suppression activity of the proapoptotic regulator Par4. EMBO Reports 6 577583.[CrossRef][Web of Science][Medline]
Gelmann EP 2002 Molecular biology of the androgen receptor. Journal of Clinical Oncology 20 30013015.
Gonzalez MI & Robins DM 2001 Oct-1 preferentially interacts with androgen receptor in a DNA-dependent manner that facilitates recruitment of SRC-1. Journal of Biological Chemistry 276 64206428.
Guo Q, Fu W, Xie J, Luo H, Sells SF, Geddes JW, Bondada V, Rangnekar VM & Mattson MP 1998 Par-4 is a mediator of neuronal degeneration associated with the pathogenesis of Alzheimer disease. Nature Medicine 4 957962.[CrossRef][Web of Science][Medline]
Gurumurthy S & Rangnekar VM 2004 Par-4 inducible apoptosis in prostate cancer cells. Journal of Cellular Biochemistry 91 504512.[CrossRef][Web of Science][Medline]
Hakimi JM, Rondinelli RH, Schoenberg MP & Barrack ER 1996 Androgen-receptor gene structure and function in prostate cancer. World Journal of Urology 14 329337.[Web of Science][Medline]
Heinlein CA & Chang C 2002 Androgen receptor (AR) coregulators: an overview. Endocrine Reviews 23 175200.
Hosohata K, Li P, Hosohata Y, Qin J, Roeder RG & Wang Z 2003 Purification and identification of a novel complex which is involved in androgen receptor-dependent transcription. Molecular and Cellular Biology 23 70197029.
Hu Z, Ito T, Yuri K, Xie C, Ozawa H & Kawata M 1998 In vivo time course of morphological changes and DNA degradation during the degeneration of castration-induced apoptotic prostate cells. Cell and Tissue Research 294 153160.[CrossRef][Web of Science][Medline]
Hupp TR, Sparks A & Lane DP 1995 Small peptides activate the latent sequence-specific DNA binding function of p53. Cell 83 237245.[CrossRef][Web of Science][Medline]
Janne OA, Moilanen AM, Poukka H, Rouleau N, Karvonen U, Kotaja N, Hakli M & Palvimo JJ 2000 Androgen-receptor-interacting nuclear proteins. Biochemical Society Transactions 28 401405.[Web of Science][Medline]
Jayaraman J & Prives C 1995 Activation of p53 sequence-specific DNA binding by short single strands of DNA requires the p53 C-terminus. Cell 81 10211029.[CrossRef][Web of Science][Medline]
Johnson PF & McKnight SL 1989 Eukaryotic transcriptional regulatory proteins. Annual Review of Biochemistry 58 799839.[CrossRef][Web of Science][Medline]
Johnstone RW, See RH, Sells SF, Wang J, Muthukkumar S, Englert C, Haber DA, Licht JD, Sugrue SP, Roberts T et al. 1996 A novel repressor, par-4, modulates transcription and growth suppression functions of the Wilms tumor suppressor WT1. Molecular and Cellular Biology 16 69456956.[Abstract]
Kogel D, Plottner O, Landsberg G, Christian S & Scheidtmann KH 1998 Cloning and characterization of Dlk, a novel serine/threonine kinase that is tightly associated with chromatin and phosphorylates core histones. Oncogene 17 26452654.[CrossRef][Web of Science][Medline]
Kogel D, Reimertz C, Mech P, Poppe M, Fruhwald MC, Engemann H, Scheidtmann KH & Prehn JH 2001 Dlk/ZIP kinase-induced apoptosis in human medulloblastoma cells: requirement of the mitochondrial apoptosis pathway. British Journal of Cancer 85 18011808.[CrossRef][Web of Science][Medline]
Li P, Yu X, Ge K, Melamed J, Roeder RG & Wang Z 2002 Heterogeneous expression and functions of androgen receptor co-factors in primary prostate cancer. American Journal of Pathology 161 14671474.
Liu D, Ishima R, Tong KI, Bagby S, Kokubo T, Muhandiram DR, Kay LE, Nakatani Y & Ikura M 1998 Solution structure of a TBP-TAF(II)230 complex: protein mimicry of the minor groove surface of the TATA box unwound by TBP. Cell 94 573583.[CrossRef][Web of Science][Medline]
Liu GZ, Wang H & Wang Z 2003 Identification of a highly conserved domain in the androgen receptor that suppresses the DNA-binding domainDNA interactions. Journal of Biological Chemistry 278 1495614960.
Mattson MP, Duan W, Chan SL & Camandola S 1999 Par-4: an emerging pivotal player in neuronal apoptosis and neurodegenerative disorders. Journal of Molecular Neuroscience 13 1730.[CrossRef][Web of Science][Medline]
Meyer F, Moore L, Bairati I, Lacombe L, Tetu B & Fradet Y 1999 Neoadjuvant hormonal therapy before radical prostatectomy and risk of prostate specific antigen failure. Journal of Urology 162 20242028.[CrossRef][Web of Science][Medline]
Micheau O, Lens S, Gaide O, Alevizopoulos K & Tschopp J 2001 NF-kappaB signals induce the expression of c-FLIP. Molecular and Cellular Biology 21 52995305.
Miyoshi Y, Ishiguro H, Uemura H, Fujinami K, Miyamoto H, Kitamura H & Kubota Y 2003 Expression of AR associated protein 55 (ARA55) and androgen receptor in prostate cancer. Prostate 56 280286.[CrossRef][Web of Science][Medline]
Moscat J & Diaz-Meco MT 2003 Par-4 keeps the atypical PKCs at bay. Cell Cycle 2 7172.[Medline]
Nessler-Menardi C, Jotova I, Culig Z, Eder IE, Putz T, Bartsch G & Klocker H 2000 Expression of androgen receptor coregulatory proteins in prostate cancer and stromal-cell culture models. Prostate 45 124131.[CrossRef][Web of Science][Medline]
Oettgen P, Finger E, Sun Z, Akbarali Y, Thamrongsak U, Boltax J, Grall F, Dube A, Weiss A, Brown L et al. 2000 PDEF, a novel prostate epithelium-specific ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. Journal of Biological Chemistry 275 12161225.
Pear WS, Miller JP, Xu L, Pui JC, Soffer B, Quackenbush RC, Pendergast AM, Bronson R, Aster JC, Scott ML et al. 1998 Efficient and rapid induction of a chronic myelogenous leukemia-like myeloproliferative disease in mice receiving P210 bcr/abl-transduced bone marrow. Blood 92 37803792.
Powell IJ, Tangen CM, Miller GJ, Lowe BA, Haas G, Carroll PR, Osswald MB, De Vere White R, Thompson IM Jr & Crawford ED 2002 Neoadjuvant therapy before radical prostatectomy for clinical T3/T4 carcinoma of the prostate: 5-year follow-up, Phase II Southwest Oncology Group Study 9109. Journal of Urology 168 20162019.[CrossRef][Web of Science][Medline]
Prefontaine GG, Walther R, Giffin W, Lemieux ME, Pope L & Hache RJ 1999 Selective binding of steroid hormone receptors to octamer transcription factors determines transcriptional synergism at the mouse mammary tumor virus promoter. Journal of Biological Chemistry 274 2671326719.
Richard DJ, Schumacher V, Royer-Pokora B & Roberts SG 2001 Par-4 is a coactivator for a splice isoform-specific transcriptional activation domain in WT1. Genes and Development 15 328339.
Sato N, Sadar MD, Bruchovsky N, Saatcioglu F, Rennie PS, Sato S, Lange PH & Gleave ME 1997 Androgenic induction of prostate-specific antigen gene is repressed by proteinprotein interaction between the androgen receptor and AP-1/c-Jun in the human prostate cancer cell line LNCaP. Journal of Biological Chemistry 272 1748517494.
Schuur ER, Henderson GA, Kmetec LA, Miller JD, Lamparski HG & Henderson DR 1996 Prostate-specific antigen expression is regulated by an upstream enhancer. Journal of Biological Chemistry 271 70437051.
Sells SF, Wood DP Jr, Joshi-Barve SS, Muthukumar S, Jacob RJ, Crist SA, Humphreys S & Rangnekar VM 1994 Commonality of the gene programs induced by effectors of apoptosis in androgen-dependent and -independent prostate cells. Cell Growth and Differentiation 5 457466.[Abstract]
Sells SF, Han SS, Muthukkumar S, Maddiwar N, Johnstone R, Boghaert E, Gillis D, Liu G, Nair P, Monnig S et al. 1997 Expression and function of the leucine zipper protein Par-4 in apoptosis. Molecular and Cellular Biology 17 38233832.[Abstract]
Wang Z & Roeder RG 1997 Three human RNA polymerase III-specific subunits form a subcomplex with a selective function in specific transcription initiation. Genes and Development 11 13151326.
Yu H, Diamandis EP, Zarghami N & Grass L 1994 Induction of prostate specific antigen production by steroids and tamoxifen in breast cancer cell lines. Breast Cancer Research and Treatment 32 291300.[CrossRef][Web of Science][Medline]
Received in final form 7 February 2006
Accepted 6 March 2006
Made available online as an Accepted Preprint 27 March 2006
This article has been cited by other articles:
![]() |
M. Ganapathy, R. Ghosh, X. Jianping, X. Zhang, R. Bedolla, J. Schoolfield, I-T. Yeh, D. A. Troyer, A. F. Olumi, and A. P. Kumar Involvement of FLIP in 2-Methoxyestradiol-Induced Tumor Regression in Transgenic Adenocarcinoma of Mouse Prostate Model Clin. Cancer Res., March 1, 2009; 15(5): 1601 - 1611. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Peng, F. Chen, J. Melamed, L. Chiriboga, J. Wei, X. Kong, M. Mcleod, Y. Li, C. X. Li, A. Feng, et al. Distinct nuclear and cytoplasmic functions of androgen receptor cofactor p44 and association with androgen-independent prostate cancer PNAS, April 1, 2008; 105(13): 5236 - 5241. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Nastiuk, K. Yoo, K. Lo, K. Su, P. Yeung, J. Kutaka, D. Danielpour, and J. J. Krolewski FLICE-Like Inhibitory Protein Blocks Transforming Growth Factor {beta}1-Induced Caspase Activation and Apoptosis in Prostate Epithelial Cells Mol. Cancer Res., February 1, 2008; 6(2): 231 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. V. Heemers and D. J. Tindall Androgen Receptor (AR) Coregulators: A Diversity of Functions Converging on and Regulating the AR Transcriptional Complex Endocr. Rev., December 1, 2007; 28(7): 778 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Moreno-Bueno, P. J. Fernandez-Marcos, M. Collado, M. J. Tendero, S. M. Rodriguez-Pinilla, I. Garcia-Cao, D. Hardisson, M. T. Diaz-Meco, J. Moscat, M. Serrano, et al. Inactivation of the Candidate Tumor Suppressor Par-4 in Endometrial Cancer Cancer Res., March 1, 2007; 67(5): 1927 - 1934. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |