|
|
||||||||
through its interaction with Sp1
1 Department of Cellular Biology,
2 Faculty of Pharmacy and
3 Centro Sanitario, University of Calabria, Via Pietro Bucci, cubo 4c, 87030 Arcavacata di Rende (CS), Italy
(Requests for offprints should be addressed to S Ando at the Department of Cellular Biology, University of Calabria; Email: sebastiano.ando{at}unical.it)
* (M L Panno and L Mauro contributed equally to this work)
| Abstract |
|---|
|
|
|---|
and Sp1.
| Introduction |
|---|
|
|
|---|
The previous findings of ourselves and others have disclosed novel arguments to sustain the cross-talk between the two signals, demonstrating how exposure of breast cancer cells to estradiol (E2) enhances the expression of insulin receptor substrate-1 (IRS-1), a key molecule linked to phosphatidylinositol-3 kinase (PI-3K)/Akt and ERK1/ERK2 pathways, crucial for cell proliferative response and survival (Surmacz 2000, Molloy et al. 2000, Yee & Lee 2000, Mauro et al. 2001). This deduction fits well with previous evidence reporting on how the mitogenic effects of insulin or IGF-I were amplified by exposure to estrogen (Ando et al. 1998, Lee et al. 1999). In addition, breast cancer cells overexpressing IRS-1 show a marked growth advantage and reduced or abrogated estrogen growth requirements (Guvakova & Surmacz 1997). Our recent data have demonstrated that E2 is able to increase IRS-1 mRNA level through activation of the regulatory region of the IRS-1 gene (Mauro et al. 2001). Mouse IRS-1 promoter, characterized for the first time by Araki et al.(1995) in CHO cells, has furthermore been analyzed and our results show four consensus half Estrogen Responsive Elements (ERE) sequences and thirteen AP-1- and ten Sp1-binding elements. These might be important regulatory sites for the actions of estrogen. The up-regulatory effect induced by E2 on this promoter activity in both MCF-7 and CHO cells, expressing estrogen receptor
(ER
), seems to underscore a general mechanism which is not strictly related to the cell type (Mauro et al. 2001).
In the present study, we have demonstrated, through a molecular dissection of the IRS-1 promoter, how the region bearing the ERE half site, separated by 12 nucleotides from the Sp1 site (5'-AGGTCA(N)12CCGCCC-3') within nt 1500 to 1477, is responsible for the E2-induced activation of the whole IRS-1 promoter. Both electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay confirmed that the above-mentioned sequence is functionally involved in mediating the up-regulatory effect induced by E2 on IRS-1 expression. The effect, as documented for other E2-responsive genes, occurs through the interaction between ER
and Sp1 proteins, bound separately to the ERE half sequence and Sp1 responsive element respectively and present in the ERE/Sp1 region of the IRS-1 promoter (Dubik & Shiu 1992, Wu-Peng et al. 1992, Krishnan et al. 1994, Rishi et al. 1995, Porter et al. 1996, 1997, Scholz et al. 1998, Petz & Nardulli 2000, Saville et al. 2000, Khan et al. 2003).
| Materials and methods |
|---|
|
|
|---|
Dulbeccos modified essential medium (DMEM)/Hams F-12, L-glutamine, penicillin/streptomycin, calf serum (CS), bovine serum albumin (BSA), aprotinin, leupeptin, phenylmethylsulfonyl fluoride (PMSF), sodium orthovanadate, 4-OH-tamoxifen and E2 were purchased from Sigma (Milan, Italy). FuGENE 6 and poly (dI-dC) were from Roche Applied Science (Milan, Italy). Taq DNA polymerase, T4 polynucleotide kinase, 1 kb DNA ladder, dual luciferase kit, pGL2 basic vector and timidine kinase promoter (TK) Renilla luciferase plasmid were provided by Promega (Madison, WI, USA). [
32P]ATP, Sephadex G50 spin columns and the enhanced chemoluminescence (ECL) system were from Amersham Biosciences. Sp1 (1C6), ER
F10 and ß-actin antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). IRS-1 antibody was from UpState Biotechnology (New York, NY, USA). Human recombinant ER
and Sp1 proteins were obtained from Invitrogen (Carlsbad, CA, USA) and Alexis (Lausen, Switzerland) respectively.
The plasmid pBluescript SKII containing mouse IRS-1 promoter (3.3 kb) and a codifying region of the IRS-1 gene (3.4 kb) was kindly given by Dr Kaku Tsuruzoe (Research Division, Joslin Diabetes, Boston, MA, USA). pHEGO plasmid, containing the full length of ER
cDNA was generously provided by Dr Didier Picard (Department of Cellular Biology, University of Geneva, Geneva, Switzerland).
Plasmids
The sequence of the IRS-1 mouse promoter was analyzed by MatInspector V2.2 software to identify potential transcriptional regulatory sites, such as AP-1, Sp1 and ERE, other than that characterized by Araki et al.(1995). The MatInspector V2.2 software is available at the web url http://transfac.gbf.de/cgi-bin/matSearch/matsearch.pl; it allows the identification of consensus sequences of transcriptional factors through the TRANSFAC data base (http://transfact.gbf.de/TRANSFAC/) (Quandt et al.1995).
Plasmid pIRS-1-luciferase (luc) was generated by inserting the 3.3 kb fragment of the mouse IRS-1 gene promoter into the pGL2 expression vector containing a luciferase gene. The sequence was confirmed by automated sequencing analysis with a BigDye terminator cycle sequencing ready reaction kit (Applied Biosystems, Foster City, CA, USA).
IRS-1 promoter fragments (pIRS-1A-luc, pIRS-1B-luc, pIRS-1C-luc) were synthesized by unidirectional deletion using the esonuclease III reaction (Ausubel et al. 1988). pIRS-1D-luc was obtained by PCR using 5'-CCC TCCCTCACTCCTGCGT-3' and 5'-GGAAGATAG CCTGATCCGAG-3' as the sense and antisense primers respectively.
All ligation products were transformed into competent Escherichia coli cells (Invitrogen). Plasmids were isolated, and clones were confirmed by DNA sequencing. pHEGO plasmid contains the full-length ER
cDNA. The Renilla luciferase reporter vector pRL-TK (Promega) was used as a transfection standard to normalize transfection efficiency.
PCR mutagenesis
The plasmids pEREmut-luc, pERE1,2,3,mut-luc and pERE4 mut-luc were generated by PCR mutagenesis (Clackson et al. 1991).
pEREmut-luc contained mutation of all ERE half sites, located at sites nt 2218 to 2213, 2128 to 2123, 2050 to 2045 and 1500 to 1495. To generate this plasmid, PCRs were performed using the primers 1s (3'-GGCACCTCAGAGCAGATGG-5') and 2a (5'-TGGGGGCGCTGGGGCGGAGGGGACGACCCAACAGGTAAAGGCGACCCCCG-3') to obtain the amplified product A (nt 3350 to 2240); the non-mutagenic external primer 3s (3'-CGTCTAATGC TCGTGCAAAC-5') and the mutagenic internal primer 6a (5'-TGGGGGCGCTGGGGCGGAGGGGACGACCCAACAGGTAAAGGCGACCCCCG-3') to obtain the amplified product B (nt 2026 to 1466); the mutagenic internal primer 5s (5'-CGGGGGTCGCCT TTACCTGTTGGGTCGTCCCCTCCGCCCCAGC GCCCCCA-3') and the non-mutagenic external primer 4a (3'-AGGAAGATAGCCTGATCCGA-5') to obtain the amplified product C (nt 1536 to 170). Products B and C were used as templates in a second PCR using the primers 3s and 4a (product D, nt 2026 to 170). Products A and D were restricted by BamHI (specific sites were present in primers 2a and 3s) and ligated to obtain product E, lacking all ERE half sites, which was further digested by SacI and HindIII (specific sites were present in primers 1s and 4a) and inserted in the pGL2 plasmid.
pERE1,2,3,mut-luc contained mutations of the three ERE half sites, located at the sites nt 2218 to 2213, 2128 to 2123 and 2050 to 2045, and was generated using product A, as described above, and product F (nt 2026 to 170) obtained by PCR using primers 3s and 4a. Products A and F were restricted by BamHI, ligated to obtain product G, lacking the three ERE half sites, which was further digested by SacI and HindIII and inserted in the pGL2 plasmid.
pERE4 mut-luc was mutated in the ERE half sites corresponding to nt 1500 to 1495, and was constructed using product C, as described above, and product H (nt 3350 to 1466) obtained by PCR using the primers 1s and 6a. Products C and H were used as templates in a second PCR using the primers 1s and 4a to obtain product L. The latter product was digested by SacI and HindIII and inserted in the pGL2 plasmid.
Point mutations were done by PCR-mediated site-specific mutagenesis using degenerate primers, replacing one G with T in the ERE sequences. Namely, the ERE half site was located at position nt 2218 to 2213: AGtTCA; the ERE half site was located at position nt 2128 to 2123: TtACCC; the ERE half site was located at position nt 2050 to 2045: TCAAtG; the ERE half site was located at position nt 1500 to 1495: AGtTCA (mutations are shown as lower case letters).
Cell lines and culture conditions
CHO cells were obtained from the American Type Culture Collection (Manassas, VA, USA). Wild-type human breast cancer (MCF-7) cells were a gift from Dr E Surmacz (Kimmel Cancer Institute, Philadelphia, PA, USA).The cell lines were cultured in DMEM/Hams F12 (1:1) medium supplemented with 5% CS, 1% L-glutamine and 1% penicillin/streptomycin. The cells were cultured in phenol red-free, serum free medium, DMEM (PRF-SFM-DMEM) containing 0.5% BSA, 1% L-glutamine and 1% penicillin/streptomycin, 24 h before each experiment.
Transfections and luciferase assay
CHO and MCF-7 cells were seeded (1 x 105 cells/well) in DMEM/F-12 supplemented with 5% CS in 24-well plates. CHO cells were cotransfected with pIRS-1-luc promoter construct and pHEGO. Cells were transfected in SFM using FuGENE6 according to the manufacturers instructions with a mixture containing 1 µg/well of each specific plasmid and 25 ng/well of TK Renilla luciferase plasmid. An empty pGL2 vector was used as the control vector to measure basal activity. Twenty-four hours after the transfection the medium was changed and the cells were treated in PRF-SFM-DMEM in the presence of 10 pM and 1, 10 and 100 nM E2. The firefly and Renilla luciferase activities were measured by using a dual luciferase kit. The firefly luciferase data for each sample were normalized on the basis of the transfection efficiency measured by Renilla luciferase activity.
Western blotting
CHO and MCF-7 cells were grown in 100 mm dishes to 7080% confluence, shifted to SFM for 24 h and lysed. Protein lysates were obtained with a buffer containing 50 mM HEPES, pH 7.5, 150 mM NaCl, 1.5 mM MgCl2, 10 mM EGTA, pH 7.5, 10% glycerol, 1% Triton X-100 and protease inhibitors (2 µM Na3Vo4, 1% PMSF and 20 µg/ml aprotinin).
The expression of IRS-1 was tested by Western blotting in 50 µg protein lysates using an anti-IRS-1 antibody. Proteins were separated by SDS-PAGE and then transferred to a nitrocellulose membrane, probed with primary antibody and then stripped and reprobed with ß-actin antibody. The antigenantibody complex was detected by incubation of the membranes for 1 h at room temperature with a peroxidase-coupled anti-IgG antibody and revealed using the ECL system. Blots were then exposed to film and bands were quantified by densitometer. The results obtained are expressed in terms of arbitrary densitometric units.
Gel mobility shift assay
Nuclear extracts were prepared from CHO cells as previously described (Andrews & Faller 1991). The probe was generated by annealing single stranded oligonucleotides and labeled with [
32P]ATP and T4 polynucleotide kinase, and then purified using Sephadex G50 spin columns. The DNA sequences used as probe or as cold competitors were as follows (the nucleotide motifs of interest are underlined, mutations are shown as lower case letters): Sp1 5'-GTTGGGACTTGGCAGCt CGCCTCCCCCTGCCCAAG-3'; ERE/Sp1 5'-GAG AGCTAGCAGtTCACCCGCGTCCCCTCtGCCCCA GCGCCCCCACCCTC-3'. The DNA sequence used as ERE cold competitor was as follows: 5'-TCCCCCTGCAAGGTCACGGTGGCCACCCCGTG-3'. Oligonucleotides were synthesized by MWGBiotech (Ebersberg, Germany). The protein binding reactions were carried out in 20 µl buffer (20 mM HEPES, pH 8, 1 mM EDTA, 50 mM KCl, 10 mM dithiothreitol (DTT), 10% glycerol, 1 mg/ml BSA, 50 µg/ml poly (dI-dC)) with 50 000 c.p.m. labeled probe, 20 µg CHO nuclear protein or an appropriate amount of ER
or Sp1 human recombinant proteins, and 5 µg poly (dI-dC). The mixtures were incubated at room temperature for 20 min in the presence or absence of unlabeled competitor oligonucleotides. The specificity of the binding was tested by adding specific antibodies (anti-ER
and anti-Sp1) to the reaction mixture. The entire reaction mixture was electrophoresed through a 4% polyacrylamide gel in 0.25 x Tris borate-EDTA for 3 h at 150 V. The gel was dried and subjected to autoradiography at 70 °C.
ChIP and Reverse (Re)-ChIP assays
We followed the ChIP methodology described by Morelli et al.(2004). CHO cells were transiently transfected with pHEGO plasmid and treated with 100 nM E2 for 1 h, or left untreated in SFM. The cells were then cross-linked with 1% formaldehyde and sonicated. Supernatants were immunocleared with sonicated salmon DNA/protein A agarose (Upstate Biotechnology Inc., New York, NY, USA) and immunoprecipitated with anti-ER
antibody (Ab) F-10 (Santa Cruz Biotechnology). Pellets were washed as reported in Morelli et al.(2004), eluted with elution buffer (1% SDS and 0.1 M NaHCO3) and digested with proteinase K (Morelli et al. 2004). DNA was obtained by phenol/chloroform extractions and precipitated with EtOH. PCR was carried out with the ERE/Sp1 primers: upstream 5'-CTCACCCAGACAC CGACATC-3' and downstream 5'-ACGCCCGTGC CACCCAGAGC-3', or with the primers amplifying the IRS-1 promoter region containing the three upstream and non-functional ERE half sequences: upstream 5'-CAGGCAGTCTAGTGGATTGA-3' and downstream 5'-TGTGTATATGTTAGCAGATGTTTG-3'.
In Re-ChIP experiments, complexes from ER
immunoprecipitations (IPs) were eluted in RE-ChIP buffer (0.5 mM DTT, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl and 20 mM TrisHCl, pH 8.1) and subjected again to the ChIP procedure by using anti-Sp1 antibody PEP2 (Santa Cruz Biotechnology). Inputs were used as loading control and were obtained by eluting DNA from 5 µl cell lysates prior to the IP step. Negative control was performed using normal IgGs in place of the primary antibody.
Statistical analysis
Each data point represents the means ± S.D. of at least three experiments. The data were analyzed by ANOVA using the STATPAC computer program (Statpac Inc., Bloomington, MN, USA).
| Results |
|---|
|
|
|---|
Sequencing of the IRS-1 mouse promoter by MatInspector V2.2 software (see Materials and methods) led us to the identification of new potential transcriptional regulatory sites, in addition to those characterized by Araki et al.(1995), namely thirteen AP-1, ten Sp1 and four ERE half sites (Fig. 1
). All these sites could be potential targets of E2 action resulting in the activation of the IRS-1 promoter.
|
In CHO cells transiently co-transfected with pHEGO and pIRS-1-luc, encoding the full length of IRS-1 gene promoter linked to the firefly luciferase reporter gene, E2 (10 pM and 1, 10 and 100 nM) was able to induce luciferase activity (Fig. 2A
). The same results were obtained in ER-positive human breast cancer MCF-7 cells transfected with pIRS-1-luc (Fig. 2B
). E2 up-regulated IRS-1 protein content in both CHO and MCF-7 cells in a dose-dependent manner (Fig. 3
).
|
|
|
|
On the basis of these findings, our attention was focused on the sequence ERE/Sp1 assumed to be a putative regulatory region target of E2 action.
EMSA study
Nuclear extracts of CHO cells were incubated in the presence of ERE/Sp1-labeled oligonucleotide to prove if this region was able to bind ER
and/or Sp1 proteins. Nuclear proteins from CHO cells revealed the presence of a single band (Fig. 6
, lane 1), which was inhibited by a 100-fold molar excess of the homologous ERE/Sp1 cold competitor (Fig. 6
, lane 2), but remained substantially unchanged in the presence of the cold mutated competitor (Fig. 6
, lane 3). The results showed an enhanced binding of the nuclear extracts, obtained from CHO cells over-expressing ER
, to the ERE/Sp1-labeled oligonucleotide (Fig. 6
, lane 5) and particularly evident upon E2 treatment (Fig. 6
, lane 8). Both bands were abrogated by a 100-fold molar excess of the cold competitor (Fig. 6
, lanes 6 and 9). The specificity of the binding was demonstrated by immunodepletion induced by ER
and Sp1 antibodies (Fig. 6
, lanes 10 and 11).
|
protein per se was unable to bind the Sp1 sequence (Fig. 7
at a lower concentration and Sp1 proteins resulted in a clearly enhanced Sp1DNA binding (Fig. 7
was drastically attenuated in the presence of cold ERE oligonucleotide (Fig. 7
were able to bind this sequence (Fig. 8A
|
|
enhanced Sp1 binding to the ERE/Sp1 sequence (Fig. 8B
binding (Fig. 8BNo cross-reaction was observed between the two specific antibodies (data not shown).
ER
and Sp1 are recruited to the ERE/Sp1 sequences of the IRS-1 promoter in CHO cells
The binding of ER
and Sp1 to the ERE/Sp1-containing sequence of the IRS-1 gene promoter was confirmed by ChIP assays. CHO cells were transiently transfected with pHEGO and treated or not treated with E2 for 1 h. The chromatin was immunoprecipitated with anti-ER
anti-body. Eluates from ER
IPs were re-immunoprecipitated with anti-Sp1 antibody (Re-ChIP) to confirm the co-existence of ER
/Sp1 complex on the promoter (Fig. 9
). The recovered DNA, opportunely amplified by using specific primers mapping the ERE/Sp1-containing sequence, showed an increased occupancy of this region by the two proteins under E2 treatment (Fig. 9
). No effect was observed when the amplified DNA region contained the other three non-functional ERE half sequences (data not shown).
|
Our previous findings have shown how treatment of CHO cells and estrogen-responsive positive breast cancer cell lines with E2, for up to 24 h, revealed an up-regulatory effect of E2 on the regulator region of the mouse IRS-1 gene (Mauro et al. 2001). We have here demonstrated that E2 at concentrations ranging from 10 pM to 100 nM produces the same up-regulatory effect on IRS-1 protein content in both CHO and human breast cancer MCF-7 cells. This suggests that there is a common regulatory mechanism controlling IRS-1 expression in the human and the mouse.
In order to investigate the molecular mechanism underlying the up-regulatory effect of E2 on the mouse IRS-1 promoter we used the same cell type where it had been first functionally characterized. With this aim, we transiently co-transfected CHO cells with the mouse IRS-1 promoter and pHEGO and tested the response to different doses of E2 ranging from 10 pM to 100 nM. The mouse IRS-1 gene, like other housekeeping genes, lacks the typical TATA and CAAT boxes (Araki et al. 1995) and contains thirteen AP-1- and ten Sp1-binding sites and four ERE half sites.
It appears that in addition to binding to a classic ERE element, the ER may also modulate transcription indirectly by interaction with other DNA-binding proteins. Actually, ER interaction with AP-1-bound fos and jun proteins confers E2 responsiveness to the ovoalbumin (Gaub et al. 1990), c-fos (Weisz & Rosales 1990), collagenase (Webb et al. 1992) and IGF-I (Umayahara et al. 1994) genes. However, previous studies have demonstrated ligand- and cell-context specific differences in ER
/Ap1 and ERß/Ap1 action. For example, in HeLa cells both estrogens and anti-estrogens activated ER
/Ap1, but only anti-estrogens activated ERß/Ap1 (Paech et al. 1997). Thus, the latter observation led us to investigate whether the region of the IRS-1 promoter rich in AP-1-binding sites was responsive to E2. Our results have shown that the AP-1-rich region failed to be up-regulated by E2.
When we extended the molecular dissection downstream to implement the AP-1-rich region with the ERE half sites, the unresponsiveness to E2 was still persistent. In contrast, the remaining downstream region of the IRS-1 promoter rich in Sp1-binding sites appears per se to be responsive to E2 stimulation.
EMSA studies, performed in a cell-free system, using an oligonucleotide reproducing the Sp1 sequence present in the mouse IRS-1 promoter, revealed how ER
did not bind the Sp1 sequence but was able to enhance Sp1 binding to its own responsive element.
Sp1 was originally described as a trans-acting factor that bound to the GC box and activated transcription of the SV40 promoter (Dynan & Tjian 1983, Gidoni et al. 1984). However, it has been subsequently identified as a higher affinity consensus Sp1 site 5'-GGGGCGG GGC-3' and it has been also discovered that the sequences that varied from this consensus sequence displayed decreased affinities for Sp1 (Briggs et al. 1986). It is worth noting how the GC-rich region, when present in the full length of the IRS-1 mouse promoter mutated for deletion in all four ERE half sites, loses its intrinsic E2 responsiveness. This led us to investigate the potential role of ERE half site as involved in IRS-1 E2 responsiveness, taking into account the ability of ER
to bind as a monomer to the consensus ERE half site (Wood et al. 1998). Among the different ERE half sites tested, only the ERE at the position nt 1500 to 1495, appears to be crucial in conferring E2 responsiveness to the whole promoter. The latter ERE half site was the closest one to the Sp1 sequence nt 1482 to 1477. Indeed, in CHO cells, only the construct bearing the ERE/Sp1 sequence has reproduced the same pattern of E2 responsiveness as that given by the full length IRS-1 promoter. Because of this we reasonably postulated a functional interaction between ERE half sites and the Sp1-rich region downstream.
Results from the EMSA showed that the binding of the untreated nuclear extract to the labeled ERE/Sp1 oligonucleotide, bearing both ERE half site and Sp1 sequence (5'-GGTCAN(12)CCGCCC-3'), resulted in a single band which was enhanced in the presence of ectopic ER
and drastically increased upon prolonged E2 exposure. In the latter condition, a clear immuno-depletion occurred in the presence of either anti-Sp1 or anti-ER
antibodies.
The ability of Sp1 and ER
to bind separately was demonstrated by two distinct bands which were abrogated in the presence of an excess of cold oligonucleotide and immunodepleted in the presence of an anti-ER
antibody in a cell-free system.
Progressively increased amounts of purified ER
protein enhanced Sp1 binding to the half ERE/Sp1-binding site in a dose-dependent manner, while increased amounts of Sp1 were unable to do so.
All these data have demonstrated that ER
enhances Sp1 binding and that both ER
and Sp1 can bind directly to the half ERE/Sp1-binding site. On the other hand, the binding of ER
and Sp1 to the ERE/Sp1-containing sequence of the IRS-1 gene promoter was confirmed by ChIP assay which showed an increased occupancy of this region by the two proteins under E2 treatment. In contrast, this was not observed when, in the ChIP assay, we used the sequence containing the first three ERE half sites. On the basis of these findings, it emerges that the ERE/Sp1-binding site is crucially involved in mediating E2 responsiveness to the IRS-1 gene. In contrast, the three non-functional ERE half sequences upstream of the ERE/Sp1 site are not involved in the process. This finding acquired relevance when we became aware of how the functional synergism between Sp1 and ER
, through the formation of the ER
/Sp1 complex, was responsible of the activation of other E2-responsive genes. For instance, in the promoter region of such genes the half palindromic ERE sequence and Sp1 were separated by a number of nucleotides ranging from 10 to 23 nt, such as cyclin D1, bcl2, retinoic acid receptor
1, IGF-binding protein 4, adenosine deaminase, DNA polymerase
, c-fos, cathepsin D, transcription factor-E2F1, creatine kinase B, human progesterone receptor A promoter and, recently, cad gene (Dubik & Shiu 1992, Wu-Peng et al. 1992, Krishnan et al. 1994, Rishi et al. 1995, Porter et al. 1996, 1997, Scholz et al. 1998, Wang et al. 1998, Petz & Nardulli 2000, Salvatori et al. 2000, Saville et al. 2000, Tanaka et al. 2000, Vyhlidal et al. 2000, Li et al. 2001, Khan et al. 2003).
While models of DNA are typically drawn in a linear array, the packaging of DNA and proteins into the nucleus of a cell requires tremendous compaction. This compaction could facilitate interaction between transacting factors bound to more distant cis elements. For instance, both ER
and SP1 are known to directly associate with the Transcription Factor (TFII) component. In particular, Sp1 has been reported to recruit TFII/TFII-binding protein and mediate formation of the transcription preinitiation complex on the TATA-less promoter (Pugh & Tjian 1991).
On the other hand, ER
as is known, interacts with the TATA-binding protein (TBP) transcription factor IIb (TFIIb) and TBP-associated factor (TAF)II30 (Ing et al. 1992, Jacq et al. 1994, Sabbah et al. 1998)). Thus, we can reasonably assume that the interaction of ER
and SP1, by recruiting TFII/TFII-binding protein, could foster the formation of a proteinprotein network that helps to establish an active transcriptional complex. Furthermore, the E2-dependent recruitment of coactivators such as CREB binding protein (CBP)/p300, which can function as a histone acetyltransferase (Ogryzko et al. 1996), could help remodel chromatin in different promoters and enhance formation of an interconnected proteinprotein and proteinDNA network involved in activation of the IRS-1 gene.
Thus, the active complex ER
/E2-Sp1 could trigger the interaction between trans-acting factors bound to more distant cis elements, like the GC downstream elements, potentiating the transcriptional machinery at the level of the whole GC-rich region of the IRS-1 promoter, which is a region reported to have positive active elements on IRS-1 promoter activity (Araki et al. 1995).
Thus, with the present findings, we have demonstrated the molecular mechanism through which E2/ER
up-regulates mouse IRS-1 expression, thereby amplifying IGF-I/insulin signaling.
Since IRS-1 is sufficient to increase rRNA synthesis and cell size (Sun et al. 2003), its enhanced expression, upon prolonged E2 exposure, may establish another intriguing link between E2, cell growth and its mitogenic potentiality.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Andrews NC & Faller DV 1991 A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Research 19 2499.
Araki E, Haag BL, Matsuda K, Shichiri M & Kahn R 1995 Characterisation and regulation of the mouse insulin receptor substrate gene promoter. Molecular Endocrinology 9 13671379.[Abstract]
Ausubel FM, Brent R, Kingston RE, Moore DD, SeidmanJD & Struhl K 1988 Enzymatic manipulation of DNA and RNA. In Current Protocols in Molecular Biology, vol.1. pp 3.0.13.17.3 Hoboken, NJ: John Wiley & Sons Inc.
Briggs MR, Kadonaga JT, Bell SP & Tjian R 1986 Purification and biochemical characterization of the promoter-specific transcription factor, Sp1. Science 234 4752.
Clackson T, Gussow D & Jones PT 1991 General application of PCR to gene cloning and manipulation. In PCR. A Pratical Approach. pp 185192. Eds MJ McPherson, P Quirke & GR Taylor. New York: Oxford University Press.
Dickson RB & Lippman ME 1987 Estrogenic regulation of growth factor secretion in human breast carcinoma. Endocrine Reviews 8 2943.[ISI][Medline]
Dickson RB & Lippman ME 1995 Growth factors in breast cancer. Endocrine Reviews 16 559589.[CrossRef][ISI][Medline]
Dubik D & Shiu R 1992 Mechanism of estrogen activation of c-myc oncogene expression. Oncogene 7 15871594.[ISI][Medline]
Dynan WS & Tjian R 1983 The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell 35 7987.[CrossRef][ISI][Medline]
Gaub MP, Bellard M, Scheuer I, Chambon P & Sassone-Corsi P 1990 Activation of the ovalbumin gene by the estrogen receptor involves the Fos-Jun complex. Cell 63 12671276.[CrossRef][ISI][Medline]
Gidoni D, Dynan WS & Tjian R 1984 Multiple specific contacts between a mammalian transcription factor and its cognate promoters. Nature 312 409413.[CrossRef][Medline]
Guvakova MA & Surmacz E 1997 Overexpressed IGF-I receptors reduce estrogen growth requirements, enhance survival, and promote E-cadherin-mediated cellcell adhesion in human breast cancer cells. Experimental Cell Research 231 149162.[CrossRef][ISI][Medline]
Ing NH, Beekman JM, Tsai SY, Tsai MJ & OMalley BW 1992 Members of the steroid hormone receptor superfamily interact with TFIIB (S300-II). Journal of Biological Chemistry 267 1761717623.
Jacq X, Brou C, Lutz Y, Davidson I, Chambon P & Tora L 1994 Human TAFII30 is present in a distinct TFIID complex and is required for transcriptional activation by the estrogen receptor. Cell 79 107117.[CrossRef][ISI][Medline]
Khan S, Abdelrahim M, Samudio I & Safe S 2003 Estrogen receptor/Sp1 complexes are required for induction of cad gene expression by 17 beta-estradiol in breast cancer cells. Endocrinology 144 23252335.
Krishnan V, Wang X & Safe S 1994 Estrogen receptor-Sp1 complexes mediate estrogen-induced cathepsin D gene expression in MCF-7 human breast cancer cells. Journal of Biological Chemistry 269 1591215917.
Lee AV, Jackson JG, Gooch JL, Hilsenbeck SG, Coronado-Heinsohn E, Osborne CK & Yee D 1999 Enhancement of insulin-like growth factor signaling in human breast cancer: estrogen regulation of insulin receptor substrate-1 expression in vitro and in vivo. Molecular Endocrinology 13 787796.
Li C, Briggs MR, Ahlborn TE, Kraemer FB & Liu J 2001 Requirement of Sp1 and estrogen receptor alpha interaction in 17 beta-estradiol-mediated transcriptional activation of the low density lipoprotein receptor gene expression. Endocrinology 142 15461553.
Mauro L, Salerno M, Panno ML, Bellizzi D, Sisci D, Miglietta A, Surmacz E & Ando S 2001 Estradiol increases IRS-1 gene expression and insulin signaling in breast cancer cells. Biochemical and Biophysical Research Communication 288 685689.
Molloy CA, May FEB & Westley BR 2000 Insulin receptor substrate-1 expression regulated by estrogen in the MCF-7 human breast cancer cell line. Journal of Biological Chemistry 275 1256512571.
Morelli C, Garofalo C, Sisci D, del Roncon S, Cascio S, Tu X, Vecchione A, Sauter ER, Miller WH Jr & Surmacz E 2004 Nuclear insulin receptor substrate 1 interacts with estrogen receptor alpha at ERE promoters. Oncogene 23 75177526.[CrossRef][ISI][Medline]
Ogryzko VV, Schiltz RL, Russanova V, Howard BH & Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87 953959.[CrossRef][ISI][Medline]
Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson JA, Kushner PJ & Scanlan TS 1997 Differential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sites. Science 277 15081510.
Petz LN & Nardulli AM 2000 Sp1 binding sites and an estrogen response element half-site are involved in regulation of the human progesterone receptor A promoter. Molecular Endocrinology 14 972985.
Porter W, Wang F,Wang W, Duan R & Safe S 1996 Role of estrogen receptor/Sp1 complexes in estrogen-induced heat shock protein 27 gene expression. Molecular Endocrinology 10 13711378.[Abstract]
Porter W, Saville B, Hoivik D & Safe S 1997 Functional synergy between the transcription factor Sp1 and the estrogen receptor. Molecular Endocrinology 11 15691580.
Pugh BF & Tjian R 1991 Transcription from a TATA-less promoter requires a multisubunit TFIID complex. Genes and Development 5 19351945.
Quandt K, Frech K, Karas H, Wingender E & Werner T 1995 MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Research 23 48784884.
Rishi A, Hhao ZM, Baumann R, Li XS, Sheikh S, Kimura S, Bashirelahi N & Fontana J 1995 Estradiol regulation of the human retinoic acid receptor gene in human breast carcinoma cells is mediated via an imperfect half-palindromin estrogen response element and Sp1 motifs. Cancer Research 55 49995006.
Sabbah M, Kang KI, Tora L & Redeuilh G 1998 Oestrogen receptor facilitates the formation of preinitiation complex assembly: involvement of the general transcription factor TFIIB. Biochemical Journal 336 639646.
Salvatori L, Ravenna L, Felli MP, Cardillo MR, Russo MA, Frati L, Gulino A & Petrangeli E 2000 Identification of an estrogen-mediated deoxyribonucleic acid-binding independent transactivation pathway on the epidermal growth factor receptor gene promoter. Endocrinology 141 22662274.
Saville B, Wormke M, Wang F, Nguyen T, Enmark E, Kuiper G, Gustafsson JA & Safe S 2000 Ligand-, cell-, and estrogen receptor subtype (alpha/beta)-dependent activation at GC-rich (Sp1) promoter elements. Journal of Biological Chemistry 275 53795387.
Scholz A, Truss M & Beato M 1998 Hormone-induced recruitment of Sp-1 mediates estrogen activation of the rabbit uteroglobin gene in endometrial epithelium. Journal of Biological Chemistry 273 43604366.
Sun H, Tu X, Prisco M, Wu A, Casaburi I & Baserga R 2003 Insulin-like growth factor receptor signaling and nuclear translocation of insulin receptor substrates 1 and 2. Molecular Endocrinology 17 472486.
Surmacz E 2000 Function of the IGF-IR in breast cancer. Journal of Mammary Gland Biology and Neoplasia 5 95105.[CrossRef][ISI][Medline]
Tanaka N, Yonekura H, Yamagishi S, Fujimori H, Yamamoto Y & Yamamoto H 2000 The receptor for advanced glycation end products is induced by the glycation products themselves and tumor necrosis factor-alpha through nuclear factor-kappa B, and by 17 beta-estradiol through Sp-1 in human vascular endothelial cells. Journal of Biological Chemistry 275 2578125790.
Umayahara Y, Kawamori H, Watada H, Imano E, Iwama N, Morishima T, Yamasaki Y, Kajimoto Y & Kamada T 1994 Estrogen regulation of the insulin-like growth factor I gene transcription involves an AP-1 enhancer. Journal of Biological Chemistry 269 1643316442.
Vyhlidal C, Samudio I, Kladde MP & Safe S 2000 Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site. Journal of Molecular Endocrinology 24 329338.[Abstract]
Wang F, Hoivik D, Pollenz R & Safe S 1998 Functional and physical interactions between the estrogen receptor Sp1 and nuclear arcyl hydrocarbon receptor complexes. Nucleic Acid Research 26 30443052.
Webb P, Lopez GN, Greene GL, Baxter JD & Kushner PJ 1992 The limits of the cellular capacity to mediate an estrogen response. Molecular Endocrinology 6 157167.[Abstract]
Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney E, Katzenellenbogen BS, Enmark E, Gustafsson JA, Nilsson S & Kushner PJ 1999 The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Molecular Endocrinology 13 16721685.
Weisz A & Rosales R 1990 Identification of an estrogen response element upstream of the human c-fos gene that binds the estrogen receptor and the AP-1 transcription factor. Nucleic Acids Research 18 50975106.
Wood JR, Greene GL & Nardulli AM 1998 Estrogen response elements function as allosteric modulators of estrogen receptor conformation. Molecular and Cellular Endocrinology 18 19271934.
Wu-Peng X, Pugliese T, Dickerman H & Pentecost B 1992 Delineation of sites mediating estrogen regulation of the rat creatine kinase B gene. Molecular Endocrinology 6 231240.[Abstract]
Yee D & Lee AV 2000 Crosstalk between the insulin-like growth factor and estrogens in breast cancer. Journal of Mammary Gland Biology and Neoplasia 5 15.[CrossRef][ISI][Medline]
Received in final form 21 October 2005
Accepted 26 October 2005
Made available online as an Accepted Preprint 18 November 2005
This article has been cited by other articles:
![]() |
D Bonofiglio, H Qi, S Gabriele, S Catalano, S Aquila, M Belmonte, and S Ando Peroxisome proliferator-activated receptor {gamma} inhibits follicular and anaplastic thyroid carcinoma cells growth by upregulating p21Cip1/WAF1 gene in a Sp1-dependent manner Endocr. Relat. Cancer, June 1, 2008; 15(2): 545 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Mauro, S. Catalano, G. Bossi, M. Pellegrino, I. Barone, S. Morales, C. Giordano, V. Bartella, I. Casaburi, and S. Ando Evidences that Leptin Up-regulates E-Cadherin Expression in Breast Cancer: Effects on Tumor Growth and Progression Cancer Res., April 1, 2007; 67(7): 3412 - 3421. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||