JME
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Molecular Endocrinology (2006) 36 51-64    DOI: 10.1677/jme.1.01908
© 2006 Society for Endocrinology

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LeHoux, J.-G.
Right arrow Articles by Lefebvre, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LeHoux, J.-G.
Right arrow Articles by Lefebvre, A.

Novel protein kinase C-epsilon inhibits human CYP11B2 gene expression through ERK1/2 signalling pathway and JunB

Jean-Guy LeHoux and Andrée Lefebvre

Department of Biochemistry, Faculty of Medicine, University of Sherbrooke, Sherbrooke, Quebec, Canada, J1H 5N4

(Requests for offprints should be addressed to J-G LeHoux; Email: jean-guy.lehoux{at}usherbrooke.ca)


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We previously reported that H295R cells co-express three diacylglycerol (DAG)-dependent protein kinase Cs (PKCs), namely conventional (c) PKC{alpha} and novel (n) PKC{varepsilon} and PKC{vartheta}. The aim of the present work was to evaluate the implication of DAG-dependent PKCs in the activation of p44/42 MAP kinase (MAPK) by angiotensin II (Ang II) and to define the role of this pathway towards CYP11B2 regulation in H295R cells. The PKC inhibitor bisindolylmaleimide 1 (Bis) inhibited Ang II-induced p44/42 MAPK phosphorylation whereas the cPKC inhibitor Gö6976 failed to do so, thus ruling out the participation of PKC{alpha}. Ang II activated nPKC{varepsilon} and did not affect nPKC{vartheta}, pinpointing PKC{varepsilon} as the mediator of Ang II in p44/42 MAPK activation. Overexpression of wild-type ERK1 and ERK2 significantly reduced basal as well as Ang II-stimulated human -2023CYP11B2-CAT activity; conversely, the two dominant negative mutants increased them. Overexpression of constitutively active (ca) PKCsuppressed Ang II-induced -2023CYP11B2-CAT activity. Infection of H295R cells with adenoviruses (Adv) expressing caPKC{varepsilon} activated endogenous MEK1/2 and p44/42 MAPK. Adv-caPKC{varepsilon} inhibited Ang II-stimulated aldosterone synthase mRNA levels and this action was reversed by the MEK1 inhibitor, PD98059. Also, Ang II increased JunB protein levels and this effect was inhibited by PD98059 and Bis. Adv-caPKC{varepsilon} enhanced JunB protein levels and PD98059 attenuated the increase. JunB overexpression abolished the Ang II-induced promoter activity within -138 bp of the 5'-flanking region of CYP11B2. Collectively, these results demonstrate that PKC{varepsilon} inhibits CYP11B2 transcription through the p44/42 MAPK pathway and JunB in H295R cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Aldosterone synthase (P450 aldo), the product of the CYP11B2 gene, is responsible for the final steps of aldosterone synthesis in the adrenal cortex zona glomerulosa (Pascoe et al. 1995, LeHoux et al. 1996a). In vivo, this key regulatory enzyme is under the control of many factors including angiotensin II (Ang II), adrenocorticotrophin and changes in blood Na+ and K+ concentrations (LeHoux et al. 1996a).

The human adrenocortical carcinoma cell line H295R (Rainey et al. 1994, Rainey & Mrotek 1998) responds to Ang II in a similar manner to glomerulosa cells in primary culture and expresses genes required for the synthesis of all types of adrenal steroids including aldosterone; this cell line has been utilized as a model for glomerulosa cell biology to study the regulation of CYP11B2 gene transcription. In transiently transfected H295R cells with gene reporter constructs containing the 5'-flanking region of CYP11B2, Ang II increased promoter activity through the involvement of calcium and calmodulin kinase I (Condon et al. 2002); in contrast to Ang II, the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA), a diacylglycerol (DAG) analogue, not only failed to increase CYP11B2 promoter activity (Clyne et al. 1996, 1997, LeHoux & Lefebvre 1998, Sarazin et al. 1998), but also abolished the enhancing effect of Ang II on cytochrome P450 aldosterone synthase (P450 aldo) mRNA levels (LeHoux et al. 2001) and CYP11B2 promoter activity (LeHoux & Lefebvre 1998, Sarazin et al. 1998, LeHoux et al. 2001).

Ang II has been demonstrated to induce DAG production in glomerulosa cells (Kojima et al. 1986, Hunyady et al. 1990, Natarajan et al. 1990, Bollag et al. 1991). DAG, in turn, activates DAG-dependent isoforms of protein kinase C (PKC), namely the Ca2+-dependent classic (c) PKC isoforms (cPKC {alpha}, ßI, ßII, and {gamma}), and the Ca2+-independent novel (n) PKC isoforms (nPKC {delta}, {varepsilon}, {vartheta}, and {eta}) (Garcia-Paramio et al. 1998, Mellor & Parker 1998, Parekh et al. 2000). Current knowledge supports the interpretation that PKC is involved in the regulation of steroidogenesis at, at least, two separate enzymatic steps of aldosterone synthesis, namely the transformation of cholesterol to pregnenolone (Reyland 1993) and the conversion of deoxycorticosterone to aldosterone (LeHoux & Lefebvre 1998). PKC was shown to inhibit aldosterone production in rat adrenal glomerulosa cells, where Ang II-stimulated aldosterone levels were enhanced by the PKC inhibitor staurosporine and were inhibited by the PKC activator TPA (Kojima et al. 1986, Hajnóczky et al. 1992, Rainey et al. 1994). In H295R cells, the PKC inhibitors staurosporine (Coulombe et al. 1996, 1997), bisindolylmaleimide (LeHoux & Lefebvre 1998) and Gö6976 (LeHoux et al. 2000, 2001) increased hamster CYP11B2 promoter activity. Furthermore, overexpression of constitutively active (ca) cPKC{alpha}, nPKC{varepsilon} and nPKC{vartheta} strongly inhibited Ang II-stimulated hamster CYP11B2 promoter activity; conversely the dominant negative forms enhanced the effect of Ang II (LeHoux et al. 2001). Overall, the above-mentioned data indicate that DAG-dependent PKCs have an inhibitory role in the control of aldosterone production.

Mitogen-activated protein kinases (MAPKs) are important signal transducing enzymes involved in many facets of cellular regulation (Gudermann et al. 2000). They are grouped into six major subfamilies such as ERK1/2 (also known as p44/42 MAPK), JNKs (c-Jun NH2-terminal protein kinases), SAPKs (stress-activated protein kinases), p38 MAPK, ERK6, ERK3 and ERK5. ERK1/2 are phosphorylated and activated by MEK1/2 (for review see Spät & Hunyady 2004). In aldosterone producing cells, Ang II was reported to activate the ERK, JNK and p38 MAPK pathways (Watanabe et al. 1996, McNeill et al. 1998, Tian et al. 1998, Natarajan et al. 2002, Gu et al. 2003, Li et al. 2003). Also, Ang II activated p42 MAPK via protein kinase C in bovine adrenal glomerulosa cells (Tian et al. 1998). Natarajan et al.(2002) suggested that the ERK1/2 pathway is not involved in the Ang II-dependent steroidogenic response in H295R cells, since inhibition of ERK1/2 activation did not alter Ang II-stimulated aldosterone synthesis. We reported that the MEK1 inhibitor, PD98059, enhanced P450 aldo mRNA levels and activated the human CYP11B2 promoter activity in H295R cells (LeHoux & Lefebvre 2004). Taken together, these data suggest an inhibitory role of the p44/42 MAPK pathway in CYP11B2 gene regulation.

Based on the above reports, the present work was designed to study the participation of DAG-dependent PKCs in the activation of p44/42 MAPK by Ang II and to establish the role of the p44/42 pathway in CYP11B2 regulation. Using adenovirus harbouring caPKC{varepsilon}, we have shown for the first time in H295R cells that PKC{varepsilon} is the upstream regulator of the ERK1/2 pathway and of JunB. Furthermore, we have demonstrated that, although activated by Ang II, PKC{varepsilon}, ERK1/2 and JunB are potent inhibitors of human CYP11B2 transcription.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Reagents

The PKC inhibitors bisindolylmaleimide I (Bis) and Gö6976 were purchased from Calbiochem, Cedarlane Laboratories Ltd (Hornsby, ON, Canada) and the MEK1 inhibitor PD98059 was purchased from New England Biolabs Ltd (Pickering, ON, Canada). 12-O-Tetradecanoylphorbol-13-acetate (TPA) and angiotensin II (Ang II) were obtained from Sigma-Aldrich (St Louis, MO, USA). All primary antibodies were purchased either from Cell Signaling Technology, Inc. (Beverly, MA, USA) or from Santa Cruz Biotechnology, Inc. (Santa-Cruz, CA, USA). Anti-rabbit Ig, horseradish peroxidase-linked antibody (from donkey) was purchased from Amersham Biosciences UK Ltd (Little Chalfont, Bucks, UK). Synthetic oligonucleotides were synthesized by Invitrogen Canada Inc. (Burlington, ON, Canada).

Cell culture

The human adrenocortical cancer cell line H295R was kindly provided by Dr W E Rainey (University of Texas Southwestern Medical Center, Dallas, TX, USA). Cells were maintained in Dulbecco’s Modified Eagle’s Medium:Nutrient Mixture F-12 (Ham) (1:1) (D-MEM/F-12) (Gibco Invitrogen Corp., Burlington, ON, Canada) supplemented with 1% BDTM ITS Premix (BD Biosciences, Bedford, MA, USA), 2% UTROSER SF (BioSepra SA, Villeneuve la Garenne, France), 200 µg/ml streptomycin, and 200 U/ml penicillin G. The cells were grown at 37 °C in a humidified atmosphere of 5% CO2.

Adenoviral infection

The replication-defective adenovirus (Adv) Ad5 encoding constitutively active rat PKC{varepsilon} (Adv-caPKC{varepsilon}) was kindly provided by Dr A M Samarel (Loyola University Chicago, IL, USA). As control for non-specific effects of adenoviral infection, we used replication-defective adenovirus expressing ß-galactosidase (Adv-LacZ) (a gift from Dr G Boissonneau, Université de Sherbrooke, Quebec, Canada). Adenoviruses were amplified using HEK293 cells and purified by caesium chloride discontinuous gradient according to the AdEasy application manual (Q-BIOgene, Carlsbad, CA, USA). The multiplicity of viral infection (MOI) for each virus was determined by plaque assay. H295R cells were seeded into six-well (106) or twelve-well (4 x 105) tissue culture plates and grown to 90% confluency. Cells were infected with adenoviruses at a MOI of 50 in Opti-MEM 1 reduced serum media (Gibco Invitrogen Corp.) for 5 h at 37 °C. Medium was then replaced with virus-free DMEM/Ham F12 containing 0.1% Utroser SF; four hours later medium was changed for fresh medium containing Ang II, PD98059 or vehicle alone and cells were cultured for an additional 16 h. Cells were then processed for western blotting analysis and RNA isolation.

Western blot analyses

Total cell extracts were prepared by harvesting H295R cells in Laemmli’s sample buffer (Laemmli 1970). Samples were passed through a 26-gauge needle, heated at 100 °C for 10 min and centrifuged (12 000xg) for 10 min. Nuclei were prepared using Nuclei EZ Prep from Sigma according to the manufacturer’s protocol; nuclei were then boiled in Laemmli’s sample buffer and processed as described for total cell extracts. Lysates containing 5 µg protein were separated by electrophoresis on 7.5% polyacrylamide gel and analysed by western blotting as previously described (LeHoux et al. 1992, 1996b). The membranes were exposed to primary antibodies overnight at 4 °C, followed by a horseradish peroxidase-conjugated anti-rabbit secondary antibody. Immunoreactive proteins were visualized with ECL Plus (Amersham Biosciences, UK Ltd) on a Storm 860 laser scanner instrument (Molecular Dynamics, Sunnyvale, CA, USA) and the band intensity was quantified using ImageQuant 5.0 software (Molecular Dynamics).

mRNA analysis

Total RNA was isolated from H295R cells using RNeasy (QIAGEN Inc., Mississauga, ON, Canada) and treated with DNase I. One hundred nanograms total RNA were reverse transcribed and amplified using the OneStep RT-PCR kit (QIAGEN) according to the manufacturer’s protocol. A 392 base pair (bp) fragment corresponding to exons 1 and 2 of both P450C11 and P450 aldo was amplified using the following primers: 5'ATGGCACT CAGGGCAAAGGCA3' (sense) and 5'CAAGAACAC GCCACATTTGTGC3' (antisense) (Staels et al. 1993). The PCR products were then digested with BglI and separated on a 2% agarose gel containing ethidium bromide. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control: a 239 bp fragment containing a BglI restriction site was amplified using 5'CATCCTGGGCTACACTGAGC3' (sense) and 5'TCTCTCTTCCTCTTGTGCTC3' (antisense) primers. The BglI digestion distinguished P450C11 from P450 aldo by cleaving the 392 bp P450 aldo fragment into 307 and 85 bp fragments; the conversion of the GAPDH 239 bp fragment to 176 and 63 bp fragments indicates complete BglI digestion. Gels were visualized using AlphaImager from Alpha Innotech Corporation (San Leandro, CA, USA). Quantification of aldosterone synthase and GAPDH bands was carried out by ImageQuant software.

Expression vectors and reporter construct

Generation of constitutively active PKC{varepsilon} mutant was engineered by point mutation using a PCR technique (Ho et al. 1989). A specific alanine residue in the pseudo-substrate region was substituted for a glutamic acid residue (A159E) (Pears et al. 1990). JunB was kindly provided by Dr S Jacobs-Helber (Medical College of Virginia Campus, Virginia Commonwealth University, Richmond, VA, USA). The pcDNA3.1 vector (Invitrogen) was used as the expression vector. Wild-type and dominant negative ERK1 and ERK2 were generous gifts from Dr M Cobb (University of Texas Southwestern Medical Center, Dallas, TX, USA). We have amplified by PCR a 2023 bp fragment of the human 5'flanking CYP11B2 gene using AccuPrimePfx DNA Polymerase (Invitrogen) according to the manufacturer’s protocol. The following primers were used: 5'CATCA TGAATTCTGCATCCTGTGAAATTATCCTTCA3' (sense) and 5'CATCATACTAGTCAGCTCCTGGA AGGTCTGGTGCATC3' (antisense). The reaction conditions were denaturation at 95 °C for 5 min, followed by 30 cycles at 95 °C for 15 s, annealing at 60 °C for 30 s, extension at 68 °C for 2 min, and final extension for 5 min; a second round of amplification was performed using another antisense primer: 5'CATCAT ACTAGTTCCAATGCTCCCTCCACCCTG3'; for the –138 bp construct, we used the sense primer 5'GGC CTCCAGCCTTGACCTTC3'. The PCR product was ligated into SpeI and blunted-SphI sites upstream of our modified pCAT basic reporter gene (Coulombe et al. 1996, 1997); the construct was confirmed by DNA sequencing.

Transient transfections and chloramphenicol acetyltransferase (CAT) activity

Transient transfections were performed in H295R cells as previously described (LeHoux et al. 2001). H295R cells (106) were seeded into 6-well plates and grown to 80–90% confluency. The cells were transfected with plasmid constructs using the FuGene 6 transfection reagent (Roche Diagnostics Corp., Indianapolis, IN, USA) and according to the manufacturer’s protocol. After 5 h, medium was changed for D-MEM/F-12 supplemented with 2% Utroser SF and cells were incubated overnight to allow recovery and expression of foreign DNA. Medium was then changed for low serum medium (D-MEM/F-12 containing 0.1% Utroser SF) and cells were treated for 16 h. with either Ang II 10–7 M or vehicle. Cell lysates were prepared by freeze-thawing and CAT assays were performed using [14C]chloramphenicol as previously described (LeHoux & Lefebvre 1998). Quantification of CAT activity was carried out using a Storm 860 laser scanner instrument (Molecular Dynamics).

Electromobility shift assays

Nuclear extracts from angiotensin-treated H295R cells were prepared as described by Schreiber et al.(1989). Shift assays using double-stranded oligonucleotide containing CYP11B2 Ad1 sequence (sense strand: 5'CTCCCATGACGTGATATGTTT 3') were performed as previously described (Coulombe et al. 1997). Bold letters in sequence represent CRE-like sequence.

Statistical analysis

Results were analysed for statistical differences using analysis of variance (ANOVA) followed by Dunnett’s test, using the SigmaStat program for Windows (Jandel Corporation, San Rafael, CA, USA).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mechanism of Ang II-induced p44/42 activation in H295R cells

We previously reported that H295R cells co-express three DAG-dependent PKCs, namely cPKC{alpha}, nPKC{varepsilon} and nPKC{vartheta} (LeHoux et al. 2001). In this study, initial experiments were performed to investigate the potential involvement of PKCs in the activation of p44/42 by Ang II. Using specific antibodies to the phosphorylated (activated) form, western blotting showed that Ang II-induced phosphorylation of p44/42 was blocked by the PKC inhibitor bisindolylmaleimide 1 and that the cPKC inhibitor Gö6976 failed to do so (Fig. 1AGo); under the same experimental conditions Gö6976 was able to abolish the Ang II-elicited increase in phosphoCREB (cAMP responsive element binding protein), validating the efficiency of the treatment (data not shown). Together, these results suggest the involvement of PKCs and rule out the participation of cPKC{alpha} in p44/42 MAPK activation by Ang II. We next assessed the effect of Ang II on the two nPKCs expressed in H295R. Phosphorylation is recognized as a mechanism that regulates PKC activity; Western studies were thus performed using phospho-PKC{vartheta} (Thr538) (at the activation loop) and phospho-PKC{varepsilon} (ser729) (at the carboxy terminus). Figure 1BGo shows that Ang II increased the phosphorylation of PKC{varepsilon} whereas it had no effect on PKC{vartheta}. These results pinpoint PKC{varepsilon} as the mediator of Ang II in the activation of p44/42 MAPK signalling pathway in H295R cells.


Figure 1
View larger version (27K):
[in this window]
[in a new window]
 
Figure 1 Mechanism of p44/42 MAPK activation by angiotensin II. (A) H295R cells were treated with vehicle (Ctr) or with PKC inhibitors bisindolylmaleimide1 (Bis) 3 µM or Gö6976 (Gö) 8 µM 1 h prior to the addition of 10–7 M angiotensin II (AII); cells were further incubated for 10 min. Cell lysates were immunoblotted with antibodies to phospho-p44/42 MAPK (Thr202/Tyr204) or to p44/42 MAPK. The ratio of intensity of phospho- to nonphospho-p44/42 bands was calculated as the bar graph. The value for Ctr was taken as 1. Values are means±S.E. of three independent experiments. *P< 0.05 and NS, non significant compared with Ctr value; ##P < 0.05 compared with AII. (B) Cells were incubated with vehicle (Ctr) or treated with 10–7 M AII for 10 min at 37 °C. Cells lysates were analysed by western blotting using antibodies against phospho-PKC{varepsilon} (Ser729), phospho-PKC{vartheta} (Ser/676), PKC{varepsilon} and PKC{vartheta}. Results are representative of three independent experiments.

 
ERK1 and ERK2 inhibit human CYP11B2 promoter activity

We have determined that the MEK1 inhibitor PD98059 increased aldosterone synthase mRNA levels in H295R cells (LeHoux & Lefebvre 2004), suggesting an inhibitory role of the p44/42 MAPK pathway. To further confirm the inhibitory role of p44/42 MAPK on CYP11B2 transcription, H295R cells were cotransfected with –2023CYP11B2-CAT construct reporter gene and plasmids expressing wild-type or dominant negative mutants ERK1 (K71R) and ERK2 (K52R). As seen in Fig. 2AGo, both wild-type ERK1 and ERK2 significantly reduced basal CYP11B2 promoter activity; conversely the two dominant negative mutants increased it. Moreover, the presence of wild-type ERK1 and ERK2 plasmids inhibited the Ang II-stimulated promoter activity, whereas the two dominant negative mutants enhanced it (Fig. 2BGo). Western blots represent the expression of corresponding transfected plasmids. These results demonstrate the inhibitory role played by the p44/42 MAPK pathway and rule out its participation in Ang II-induced CYP11B2 promoter activity.


Figure 2
View larger version (23K):
[in this window]
[in a new window]
 
Figure 2 Effect of ERK1 and ERK2 on human CYP11B2 promoter activity. H295R cells were cotransfected with a human –2023CYP11B2-CAT reporter construct and with either the empty expression CEP4 plasmid (Invitrogen) or the CEP4 plasmid harbouring wild-type (wt) ERK1, wtERK2, dominant negative (dn) K71R ERK1, or dnK52R ERK2. Thirty-two hours after transfection, cells were (A) untreated or (B) stimulated with 10–7 M angiotensin II for 16 h at 37 °C. Western blots represent expression of corresponding transfected plasmids in parallel experiments. Results are expressed as means±S.E.M.; n=5 independent experiments. *P< 0.05 compared with CEP4.

 
caPKC{varepsilon} suppresses the Ang II-stimulated CYP11B2 promoter activity

To test the function of PKC{varepsilon} on human CYP11B2 transcription, H295R cells were cotransfected with the –2023CYP11B2-CAT construct and a plasmid expressing the constitutively active PKC{varepsilon}. Figure 3Go shows that caPKC{varepsilon} inhibited the Ang II-stimulated CYP11B2 promoter activity by 94%. The basal promoter activity was unaffected by PKC{varepsilon} overexpression. Western blots represent the expression of caPKC{varepsilon} transfected plasmids in parallel experiments. These results corroborate our previous findings with hamster CYP11B2 promoter activity (LeHoux et al. 2001) and firmly establish the negative regulation exerted by PKC{varepsilon} on Ang II-induced CYP11B2 gene expression.


Figure 3
View larger version (18K):
[in this window]
[in a new window]
 
Figure 3 Constitutively active (ca) PKC{varepsilon} suppresses the Ang II-stimulated human CYP11B2 promoter activity. H295R cells were cotransfected with a human -2023CYP11B2-CAT reporter construct and with either the empty pcDNA3.1 plasmid or the pcDNA3.1 plasmid harbouring caPKC{varepsilon}. Thirty-two hours after transfection, cells were treated with 10–7 M angiotensin II or vehicle alone (Basal) for 16 h at 37 °C. Western blots represent expression of PKC{varepsilon} in parallel experiments. Results are expressed as means±S.E.M.; n=3 independent experiments. *P < 0.05 and NS, non significant compared with their respective pcDNA3.1.

 
Effect of caPKC{varepsilon} adenoviruses infection on endogenous DAG-dependent PKCs

Given the inhibitory role of both PKC{varepsilon} and p44/42 MAPK on CYP11B2 promoter activity, we hypothesized that PKC{varepsilon} is the upstream regulator of MEK-ERK in H295R cells. To demonstrate the involvement of PKC{varepsilon} we used an adenoviral vector expressing caPKC{varepsilon} for high-efficiency gene transfer. The viability and functionality of infected cells were first ascertained using adenoviral vector expressing LacZ. Toxicity tests revealed that under the conditions used H295R cells supported adenoviral infection (not shown). Furthermore, the increase in aldosterone levels induced by Ang II was similar for both infected and uninfected cells (not shown). The reliability of PKC{varepsilon} overexpression experiments is based on the assumption that its overproduction will not affect the behaviour of other PKCs. Therefore, we have examined if overexpression of caPKC{varepsilon} had any effects on endogenous PKC isoforms. Western blotting analysis shows that overexpression of caPKC{varepsilon} did not alter the levels of the total and the phosphorylated (activated) state of PKC{alpha} and PKC{vartheta}, thus ruling out their potential interference in subsequent experiments using Adv-caPKC{varepsilon} (Fig. 4Go).


Figure 4
View larger version (39K):
[in this window]
[in a new window]
 
Figure 4 Effect of constitutively active Adv-caPKC{varepsilon} overexpression on endogenous PKC{alpha} and PKCß protein levels and phosphorylation. H295R cells were infected with adenoviruses encoding Lac-Z or caPKC{varepsilon} (50 MOI for each virus) for 5 h at 37 °C. Cell media were then changed for adenovirus-free media and incubation proceeded for 19 h. Western blots were probed with phospho-specific and protein-specific (phosphorylated and unphosphorylated) antibodies. These results are representative of three independent experiments.

 
caPKC{varepsilon} activates MEK1/2 and p44/42 MAPK

We next investigated if caPKC{varepsilon} overexpression was sufficient to activate the endogenous MEK-ERK cascade. Western blot analysis showed that Adv-caPKC{varepsilon} increased the phosphorylation of MEK1/2 and p44/42 MAPK, without altering their respective protein levels (Fig. 5Go). These data establish the role of PKC{varepsilon} as an upstream regulator of the MEK/ERK cascade in H295R cells.


Figure 5
View larger version (33K):
[in this window]
[in a new window]
 
Figure 5 Constitutively active Adv-caPKC{varepsilon} overexpression increases the endogenous level of phospho-MEK1/2 and phospho-p44/42 MAPK. H295R cells were infected with adenoviruses encoding Lac-Z or caPKC{varepsilon} (50 MOI for each virus) for 5 h at 37 °C. N.I., non infected. Cell media were then changed for adenovirus-free media and incubation proceeded for 19 h. Western blots were probed with phospho-specific and protein-specific (phosphorylated and unphosphorylated) antibodies. These results are representative of three independent experiments.

 
Adv-caPKC{varepsilon} inhibits Ang II-induced CYP11B2 transcription via p44/42 MAPK

To demonstrate that PKC{varepsilon} inhibits Ang II-stimulated CYP11B2 gene expression via the ERK1/2 signalling pathway, we have performed semi-quantitative RT-PCR on H295R cells infected with Adv-caPKC{varepsilon} or Adv-LacZ and treated with Ang II combined or not with the MEK1 inhibitor PD98059. PKC{varepsilon} overexpression prevented the Ang II-induced aldosterone synthase mRNA level observed in Adv-LacZ infected cells, and this effect was reversed by PD98059 (Fig. 6Go). Also, PKC{varepsilon} overexpression did not impair the increase in aldosterone synthase mRNA levels by PD98059. These data establish the ERK1/2 pathway as the downstream effector of PKC{varepsilon} in the inhibition CYP11B2 gene transcription.


Figure 6
View larger version (35K):
[in this window]
[in a new window]
 
Figure 6 Constitutively active Adv-caPKC{varepsilon} overexpression inhibits Ang II-stimulated aldosterone synthase mRNA levels through ERK1/2. H295R cells were infected with Adv-Lac-Z or Adv-ca PKC{varepsilon} (50 MOI for each virus) for 5 h at 37 °C. Media were changed for adenovirus-free media containing 10–7 M angiotensin II (AII), 50 µM PD98059 (PD), AII and PD combined or vehicle alone (control, Ctr) and incubated for an additional 16 h. Total RNA was reverse transcribed using primers specific to exons 1 and 2 of both P450 11ß-hydroxylase (C11) and P450 aldosterone synthase (AS) genes and then PCR amplified. GAPDH primers were used as an internal control. The PCR products were then digested with BglI to separate AS from C11. The ratio of intensity of AS to GAPDH bands was calculated as the bar graph. The value for Adv-Lac-Z Ctr was taken as 1. Values are means±S.E. of three independent experiments. *P < 0.05 and NS, non significant compared with Adv-Lac-Z Ctr value.

 
Induction of jun family members by Ang II

Angiotensin II was reported to induce the expression of several early genes in glomerulosa cells (Clark et al. 1992). We next assessed the effect of Ang II on the protein expression of the main jun family members in H295R cells. Figure 7AGo shows that cJun and JunB protein levels were increased after 3 h of treatment; the level of cJun protein returned to control levels at the 16 h time point whereas the increase in JunB was still elevated after 24 h of Ang II treatment. Compared with control, JunD protein levels were not enhanced by Ang II. The strong and sustained elevation of JunB in response to Ang II prompted us to study further its role in CYP11B2 regulation.


Figure 7
View larger version (40K):
[in this window]
[in a new window]
 
Figure 7 Time-course induction of Jun family members by Ang II. H295R cells were treated with 10–7 M angiotensin II for the indicated times. (A) Cell lysates were immunoblotted with antibodies specific to each Jun family member or to GAPDH. (B) In a different series of experiments nuclei lysates were immunoblotted with JunB antibody.

 
Ang II and PKC{varepsilon} increase JunB protein levels through p44/42 MAPK

Immediate early genes such as JunB are probably upregulated once MAP kinases are activated. We therefore studied the implication of the p44/42 MAPK pathway and PKCs in the regulation of JunB protein. Western blot analyses (Fig. 8AGo) showed that Ang II-enhanced JunB protein levels are impaired by PD98059 and bisindolylmaleimide 1, demonstrating the implication of p44/42 MAPK and PKCs in JunB upregulation by Ang II. Since PKC{varepsilon} activates p44/42 MAPK, we next assessed its effect on JunB protein levels; western blot analyses were performed on cell lysates from H295R cells infected with Adv-caPKC{varepsilon} and treated with PD98059 or vehicle only. Results showed that Adv-caPKC{varepsilon} increased JunB protein levels and that PD98059 partially prevented this increase (Fig. 8BGo), demonstrating that PKC{varepsilon} increases JunB protein levels via p44/42 MAPK.


Figure 8
View larger version (19K):
[in this window]
[in a new window]
 
Figure 8 Upregulation of JunB protein via p44/42 MAPK and PKC{varepsilon}. (A) H295R cells were treated with 50 µM PD98059 (PD) or 3 µM bisindolylmaleimide 1 (Bis) 1 h prior to the addition of 10–7 M angiotensin II (AII); cells were further incubated for 16 h. Ctr, control. (B) Cells were infected with Adv-LacZ or Adv-caPKC{varepsilon} (50 MOI for each virus) for 5 h at 37 °C. Media were then changed for adenovirus-free media containing PD98059 (PD) 50 µM or vehicle alone (control, Ctr) and incubated for an additional 19 h. Cells lysates were immunoblotted with antibodies to JunB or to GAPDH. The ratio of intensity of JunB to GAPDH bands was calculated as the bar graph. In (A), the value for control (Ctr) was taken as 1. Values are mean±S.E. of three independent experiments. *P < 0.05 and NS, non significant compared with Ctr value; ##P < 0.05 compared with AII. In (B), the value for control (Ctr) Adv-LacZ was taken as 1. Values are means± S.E. of three independent experiments. *P < 0.05 and NS, non significant compared with Adv-LacZ Ctr value; ##P < 0.05 compared with Adv-caPKC{varepsilon} Ctr value.

 
JunB inhibits the Ang II-stimulated human CYP11B2 promoter activity

To clarify the role played by JunB in CYP11B2 gene transcription, with human –2023CYP11B2-CAT or –138CYP11B2-CAT promoter constructs, and with either the empty pcDNA3.1 plasmid or the pcDNA3.1 plasmid harbouring JunB. Figure 9AGo shows that JunB overexpression completely blocked Ang II-stimulated CYP11B2 promoter activity of both constructs. The above results demonstrate that JunB is part of the inhibitory mechanism driven by PKC{varepsilon}. Since the –138CYP11B2-CAT promoter construct contains a cAMP response element (CRE)-like sequence termed Ad1, and since jun proteins have been shown to bind CRE, we have performed supershift assays to determine if JunB binds to Ad1. Figure 9BGo shows that JunB antibody supershifted the Ad1–nuclear protein complex.


Figure 9
View larger version (15K):
[in this window]
[in a new window]
 
Figure 9 JunB inhibits the Ang II-stimulated human CYP11B2 promoter activity. (A) H295R cells were cotransfected with human -2023CYP11B2-CAT or -138CYP11B2-CAT reporter construct and with either the empty pcDNA3.1 plasmid (–) or the pcDNA3.1 plasmid harbouring JunB (+). Thirty-two hours after transfection, cells were treated with 10–7 M angiotensin II or vehicle alone for 16 h at 37 °C. Western blots represent expression of JunB in parallel experiments. Results are expressed as means±S.E.M.; n=3 independent experiments. *P < 0.05 compared with their respective pcDNA3.1. (B) Supershift (SS) of CYP11B2 Ad1 by JunB antibody; 33P-labelled double-stranded oligonucleotide containing CYP11B2 Ad1 sequence was incubated with nuclear extract (20 µg protein) from angiotensin-treated H295R cells with or without JunB antibody.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In previous studies, we reported that (1) Ang II-stimulated P450 aldo mRNA levels were inhibited by the PKC activator TPA in H295R cells (LeHoux et al. 2001); (2) hamster CYP11B2 promoter activity was stimulated by the PKC inhibitor bisindolylmaleimide 1 (LeHoux & Lefebvre 1998) and the MEK1 inhibitor PD98059 (LeHoux & Lefebvre 2004); and (3) CYP11B2 promoter activity was inhibited by DAG-dependent PKCs (LeHoux et al. 2001). Taken together, these data indicated an inhibitory role played by DAG-dependent PKCs on CYP11B2 expression and pointed to the participation of the p44/42 MAPK signalling pathway. Thus the aim of the present work was to establish the implication of p44/42 MAPK in the negative regulation of human CYP11B2 and to evaluate the role of DAG-dependent PKC isoform(s) in this process. Using pharmaceutical and molecular approaches, we have shown for the first time in the H295R cells that the p44/42 MAPK signalling pathway mediates CYP11B2 transcription inhibition by PKC{varepsilon}.

Multiple studies in adrenal zona glomerulosa cells have reported ERK activation by phorbol esters (Tian et al. 1998, Fong et al. 2002) and by Ang II (Chabre et al. 1995, Watanabe et al. 1996, Tian et al. 1998, Natarajan et al. 2002). However, the role of the ERK signalling pathway in adrenal glomerulosa steroidogenesis has been the subject of controversy. A negative role was reported by Smith et al.(1999) who found that the MEK-1 kinase inhibitor PD98059 enhanced Raf-1, a MAPK kinase kinase which phosphorylates MEK, suggesting negative regulation by downstream elements of the ERK pathway. Li et al.(2003) reported that PD98059 increased basal steroidogenic acute regulatory protein (StAR) reporter gene activity in H295R cells and they concluded that the MAPK pathway is not involved in StAR transcriptional activation. One positive effect of ERK was reported by Cherradi et al.(2003) who demonstrated the participation of this pathway in the short-term steroidogenic response to Ang II; both Ang II-induced cholesterol ester hydrolase phosphorylation and pregnenolone synthesis were reduced in the presence of PD98059.

In respect to aldosterone, the MEK1/2 inhibitors U0126 and PD98059 reduced Ang II-stimulated aldosterone production in adrenal glomerulosa cells (Osman et al. 2002); similarly, Suzuki et al.(2004) reported that Ang II-induced aldosterone production was reduced by U0126 in H295R cells. However, the latter data were contradicted by those of Natarajan et al.(2002) showing that Ang II-stimulated aldosterone was not inhibited by PD98059 in H295R cells. We found that PD98059 increased the levels of aldosterone synthase mRNA (LeHoux & Lefebvre 2004) and CYP11B2 promoter activity (unpublished data) in H295R cells.

The present study proves the inhibitory role of the ERK pathway in adrenocortical steroidogenesis. Using wild-type and dominant negative forms of ERK1 or ERK2, we have demonstrated the inhibitory role of the ERK signalling pathway on Ang II-induced human CYP11B2 promoter activity. Indeed, overexpression of the wild-type ERK1/2 forms inhibited basal and Ang II-stimulated CYP11B2 promoter activity, whereas the dominant negative forms had the opposite effects (Fig. 2Go).

The inhibition of Ang II-induced CYP11B2 activity by ERKs in H295R cells is somewhat paradoxical since Ang II also transiently activates ERKs (Fig. 1AGo and see Watanabe et al. 1996, Natarajan et al. 2002, Li et al. 2003). As an explanation of this apparent discrepancy we can speculate that ERK activation functions as a negative mechanism to reduce CYP11B2 activation by Ang II. One can hypothesize that the physiological role of this inhibitory mechanism is to prevent aldosterone overproduction subsequent to sustained CYP11B2 activation. A literature survey reveals that activation of steroidogenesis is associated mostly with p38 MAPK activation; in H295R cells, Ang II significantly increased aldosterone release and this effect was inhibited by a specific p38 MAPK inhibitor, SB202190, but not by PD098059 (Natarajan et al. 2002); Ang II-induced CYP11B2 mRNA levels and CYP11B2 promoter activity were partially inhibited by SB203580 in H295R cells (Gu et al. 2003). Therefore, our results suggest that Ang II also activates a negative pathway towards CYP11B2 transcription.

PKC isoforms are tissue specific and they act via different signal transduction pathways to regulate gene expression. H295R cells express three DAG-dependent PKCs, {alpha}, {varepsilon} and {vartheta}. In human adrenal cortex, PKC{varepsilon}, PKC{varepsilon} and PKC{vartheta} are present in both zona glomerulosa and the inner zones (LeHoux et al. 2001). A key question is how each PKC isoform regulates signalling cascades. Results of the present study pinpoint PKC{varepsilon} as the DAG-dependent PKC responsible for p44/42 MAPK activation by Ang II. Indeed, bisindolylmaleimide 1 blocked p44/42 MAPK phosphorylation by Ang II while the cPKC inhibitor Gö6976 failed to do so, indicating the participation of PKCs and ruling out PKC{alpha} as activator of this pathway; Ang II activated PKC{varepsilon} and had no effect on nPKC{vartheta} (Fig. 1BGo). Activation of PKC{varepsilon} by Ang II was also reported by Natarajan et al.(1994) in rat glomerulosa cells. Co-transfection experiments showed that caPKC{varepsilon} abolished the Ang II-stimulated human CYP11B2 promoter activity (Fig. 3Go). The functional role of PKC{varepsilon} was directly investigated using adenoviral gene transfer for overexpression of constitutively active Adv-caPKC{varepsilon}. Our results showed that overexpression of caPKC{varepsilon} had no effects on endogenous PKC{alpha} and PKC{vartheta} (Fig. 4Go), suggesting that the latter PKCs did not interfere with PKC{varepsilon} action. Overexpression of caPKC{varepsilon} activated MEK1/2 and p44/42 MAPK (Fig. 5Go), providing strong evidence that PKC{varepsilon} is an upstream regulator of p44/42 MAPK in H295R cells. Our results are consistent with several observations made in other cell types (Strait et al. 2001, Yan & Wenner 2001, Ni et al. 2003, Rao et al. 2004). Heidkamp et al.(2001) demonstrated that Adv-caPKC{varepsilon} infection of ventricular myocytes induced an increase in phosphorylated p44/42 MAPK. Under our experimental conditions, Adx-caPKC{varepsilon} infection did not activate p38 MAPK and SAPK/JNK (results not shown). As reviewed by Poole et al.(2004) the differential action of PKCs on signalling pathways is controlled by several molecular mechanisms including specific partner–protein interaction; the PKC-interacting proteins thus confer specificity of individual PKC isoforms, for example, Baines et al.(2002) found that active PKC{varepsilon} forms subcellular-targeted signalling modules with ERKs, leading to the phosphorylation of ERKs. The differential activation of the MAPK pathway by PKC{varepsilon} was demonstrated in ventricular myocytes, where Adx-caPKC{varepsilon} induced an increase in phosphorylated p44/42 ERKs while it minimally activated JNK and did not affect p38 MAPK (Heidkamp et al. 2001). To our knowledge, studies reported herein are the first to directly demonstrate the activation of p44/42 MAPK by PKC{varepsilon} in adrenocortical cells.

We next assessed whether caPKC{varepsilon} overexpression induces inhibition of endogenous CYP11B2 gene transcription; Adx-caPKC{varepsilon} infection inhibited the Ang II-stimulated aldosterone synthase mRNA and this effect was reversed by PD98059 (Fig. 6Go), demonstrating that ERK1/2 is the downstream effector of PKC{varepsilon} in downregulating CYP11B2 transcription. The regulation of various genes by activators of PKC is mediated by the transcription factor activator protein-1 (AP-1). AP-1 is a family of dimeric basic region-leucine zipper proteins that recognize TPA response elements (TRE) and CRE. AP-1 dimers are composed of Jun family protein (c-Jun, JunB, JunD) homodimers, or Jun heterodimers with Fos (c-Fos, FosB, Fra-1, Fra-2), or Activating transcription factor (ATF) family proteins (Angel & Karin 1991, Shaulian & Karin 2001). Although a variety of dimers can be formed, the Jun, Fos, and ATF proteins are not functionally interchangeable. Thus signalling pathways that activate AP-1 transcription factor complexes can regulate expression of specific genes by controlling the composition of AP-1 dimers (Cuevas et al. 2005). Previous studies reported the presence of JunB in adrenal zona glomerulosa (Clark et al. 1992, LeHoux & Ducharme 1995, LeHoux & Lefebvre 1998) and we detected JunB protein in human adrenal zona glomerulosa and inner zones cells (unpublished results). The time-course analysis of Ang II treatment indicated a strong and sustained rise of JunB protein levels in H295R cells. Figure 7AGo showed that Ang II induced an increase in JunB protein levels within 3 h and that the increase was still apparent after 24 h. These results are in agreement with the report of Naville et al.(2001) who found that JunB mRNA levels were maximally increased after 1 h of treatment with Ang II; the effect, though decreasing, lasted for up to 24 h. They also reported that JunD mRNA levels were enhanced at 1 h and 3 h but not after 24 h of Ang II treatment. In contrast, our time-course study (Fig. 7AGo) showed that JunD protein levels were not increased by Ang II treatments when compared with control. While the cJun mRNA levels reported by Naville et al.(2001) were only slightly elevated 1 h after Ang II treatment, we found that c-Jun protein levels were increased at 3 h and 6 h (Fig. 7AGo). These results show that among the Jun family members, only JunB mRNA as well as protein levels were sustainedly increased up to 24 h. In a previous study (LeHoux & Lefebvre 2004), the Ang II-increased level of JunB protein in nuclear extracts was not found to be significant. Since in the present study Ang II significantly increased JunB protein levels in whole cell lysates (Fig. 7AGo), we have revisited the effect of Ang II on JunB nuclei content. Figure 7BGo clearly shows increases in nuclei JunB levels between 1 h and 24 h after Ang II treatment. The apparent discrepancy between the above results can be tentatively explained by the use of different batches of H295R cells; the Ang II-induced increases in JunB protein levels in the previous cell batch being low and consequently less accurately assessable. Here we report that Ang II increased JunB protein levels through the activation of PKC and p44/42 MAPK (Fig. 8AGo). Furthermore, we have demonstrated the upregulation of JunB protein levels by PKC{varepsilon} and found that this increase was partially impaired by PD98059 (Fig. 8BGo), showing the implication of the p44/42 MAPK pathway in this process. We have also shown that JunB overexpression inhibited the Ang II-stimulated CYP11B2 promoter activity (Fig. 9AGo), establishing the link between activation of PKC{varepsilon}, activation of JunB via the p44/p42 MAPK signalling pathway, and the resulting negative regulation of CYP11B2 in H295R cells.

Despite the lack of canonical AP-1 consensus sequence on hCYP11B2 promoter, JunB abolished the Ang II-stimulated promoter activity of both –2023CYP11B2-CAT and –138CYP11B2-CAT reporter constructs (Fig. 9AGo). The promoter region of the latter construct contains two important cis-elements: Ad1, a CRE-like cis-element, at –71/–64 and Ad5 at –129/–114. While Ad1 is mandatory (Clyne et al. 1997, Coulombe et al. 1997), both Ad1 and Ad5 are required for full basal and Ang II-induced CYP11B2 reporter activity. Ad1 was shown to bind transcription factors ATF-1, ATF-2 and CRE binding protein in H295R cells (Bassett et al. 2000, 2004). Although not the direct focus of the current studies, we have found that the JunB antibody supershifted Ad1–protein binding complexes (Fig. 9BGo). The functional meaning of that observation is yet to be determined. One can speculate, however, that JunB binding to Ad1 would be sufficient to achieve inhibition of CYP11B2; enhanced JunB expression would thus change activating protein complexes elicited by Ang II for inhibiting complexes. Alternatively, sustained JunB upregulation could affect expression of unknown transcription factors which could inhibit CYP11B2. Furthermore, transactivation by JunB depends on cooperative interactions between adjacently bound factors. Extensive studies will be needed to understand the mechanisms of JunB action, which extend beyond the aim of the present article. These studies should include binding and displacement assays of c-Jun, JunB, JunD and CRE-binding factors on Ad1 cis-element after several periods of Ang II treatment.

In conclusion, this is the first report on the inhibition of CYP11B2 transcription by the ERK1/2 pathway and JunB driven by PKC{varepsilon}. Figure 10Go is a schematic representation of the proposed inhibitory signalling pathway involving ERK and JunB.


Figure 10
View larger version (16K):
[in this window]
[in a new window]
 
Figure 10 Model depicting the proposed signalling pathway leading to CYP11B2 inhibition by PKC{varepsilon}.

 


    Acknowledgements
 
This work was supported by a grant from the Canadian Institutes of Health Research, MT-10983. J-G L is chercheur boursier de carrière from the Fonds de la recherche en santé du Québec.

We are indebted to Dr W E Rainey for providing the H295R cells. We are grateful to Dr G Boissonneault (Université de Sherbrooke, QC, Canada) for Adv-LacZ, Dr A M Samarel (Loyola University, Chicago, IL, USA) for Adv-caPKC{varepsilon}, Dr M Cobb (University of Texas Southwestern Medical Center, Dallas, TX, USA) for ERK1 and ERK2 mutants, Dr S Jacobs-Helber (Medical College of Virginia Campus, Virginia Commonwealth University, Richmond, VA, USA) for Jun B. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Angel P & Karin M 1991 The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochimica et Biophysica Acta 1072 129–157.[Medline]

Baines CP, Zhang J, Wang GW, Zheng YT, Xiu JX, Cardwell EM, Bolli R & Ping P 2002 Mitochondrial PKC-epsilon and MAPK form signaling modules in the murine heart: enhanced mitochondrial PKC-epsilon-MAPK interactions and differential MAPK activation in PKC-epsilon-induced cardioprotection. Circulation Research 90 390–397.[Abstract/Free Full Text]

Bassett MH, Zhang Y, White PC & Rainey WE 2000 Regulation of human CYP11B2 and CYP11B1: comparing the role of the common CRE/Ad1 element. Endocrine Research 26 941–951.[Web of Science][Medline]

Bassett MH, White PC & Rainey WE 2004 The regulation of aldosterone synthase expression. Molecular and Cellular Endocrinology 217 67–74.[CrossRef][Web of Science][Medline]

Bollag WB, Barrett PQ, Isales CM & Rasmussen H 1991 Angiotensin-II-induced changes in diacylglycerol levels and their potential role in modulating the steroidogenic response. Endocrinology 128 231–241.[Abstract/Free Full Text]

Chabre O, Cornillon F, Bottari SP, Chambaz EM & Vilgrain I 1995 Hormonal regulation of mitogen-activated protein kinase activity in bovine adrenocortical cells: cross-talk between phosphoinositides, adenosine 3',5'-monophosphate, and tyrosine kinase receptor pathways. Endocrinology 136 956–964.[Abstract]

Cherradi N, Pardo B, Greenberg AS, Kraemer FB & Capponi AM 2003 Angiotensin II activates cholesterol ester hydrolase in bovine adrenal glomerulosa cells through phosphorylation mediated by p42/p44 mitogen-activated protein kinase. Endocrinology 144 4905–4915.[Abstract/Free Full Text]

Clark AJ, Balla T, Jones MR & Catt KJ 1992 Stimulation of early gene expression by angiotensin II in bovine adrenal glomerulosa cells: roles of calcium and protein kinase C. Molecular Endocrinology 6 1889–1898.[Abstract/Free Full Text]

Clyne CD, White PC & Rainey WE 1996 Calcium regulates human CYP11B2 transcription. Endocrine Research 22 485–492.[Medline]

Clyne CD, Zhang Y, Slutsker L, Mathis JM, White PC & Rainey WE 1997 Angiotensin II and potassium regulate human CYP11B2 transcription through common cis-elements. Molecular Endocrinology 11 638–649.[Abstract/Free Full Text]

Condon JC, Pezzi V, Drummond BM, Yin S & Rainey WE 2002 Calmodulin-dependent kinase I regulates adrenal cell expression of aldosterone synthase. Endocrinology 143 3651–3657.[Abstract/Free Full Text]

Coulombe N, Lefebvre A & LeHoux JG 1996 Characterization of the hamster CYP11B2 gene regulatory regions. Endocrine Research 22 653–661.[Medline]

Coulombe N, Lefebvre A & Lehoux JG 1997 Characterization of the hamster CYP11B2 gene encoding adrenal cytochrome P450 aldosterone synthase. DNA Cell Biology 16 993–1002.[Medline]

Cuevas BD, Uhlik MT, Garrington TP & Johnson GL 2005 MEKK1 regulates the AP-1 dimer repertoire via control of JunB transcription and Fra-2 protein stability. Oncogene 24 801–809.[CrossRef][Web of Science][Medline]

Fong TH, Yang CC, Greenberg AS & Wang SM 2002 Immunocytochemical studies on lipid droplet-surface proteins in adrenal cells. Journal of Cell Biochemistry 86 432–439.[CrossRef][Medline]

Garcia-Paramio P, Cabrerizo Y, Bornancin F & Parker PJ 1998 The broad specificity of dominant inhibitory protein kinase C mutants infers a common step in phosphorylation. Biochemistry Journal 333 631–636.[Web of Science][Medline]

Gu J, Wen Y, Mison A & Nadler JL 2003 12-Lipoxygenase pathway increases aldosterone production, 3',5'-cyclic adenosine monophosphate response element-binding protein phosphorylation, and p38 mitogen-activated protein kinase activation in H295R human adrenocortical cells. Endocrinology 144 534–543.[Abstract/Free Full Text]

Gudermann T, Grosse R & Schultz G 2000 Contribution of receptor/G protein signaling to cell growth and transformation. Naunyn Schmiedebergs Archives of Pharmacology 361 345–362.[CrossRef][Web of Science][Medline]

Hajnóczky G, Várnai P, Buday L, Faragó A & Spät A 1992 The role of protein kinase-C in control of aldosterone production by rat adrenal glomerulosa cells: activation of protein kinase-C by stimulation with potassium. Endocrinology 130 2230–2236.[Abstract/Free Full Text]

Heidkamp MC, Bayer AL, Martin JL & Samarel AM 2001 Differential activation of mitogen-activated protein kinase cascades and apoptosis by protein kinase C epsilon and delta in neonatal rat ventricular myocytes. Circulation Research 89 882–890.[Abstract/Free Full Text]

Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR 1989 Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77 51–59.[CrossRef][Web of Science][Medline]

Hunyady L, Baukal AJ, Bor M, Ely JA & Catt KJ 1990 Regulation of 1,2-diacylglycerol production by angiotensin-II in bovine adrenal glomerulosa cells. Endocrinology 126 1001–1008.[Abstract/Free Full Text]

Kojima I, Shibata H & Ogata E 1986 Phorbol ester inhibits angiotensin-induced activation of phospholipase C in adrenal glomerulosa cells. Its implication in the sustained action of angiotensin. Biochemistry Journal 237 253–258.[Medline]

Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 680–685.[CrossRef][Medline]

LeHoux JG & Ducharme L 1995 In vivo effects of adrenocorticotropin on c-jun, jun-B, c-fos and fos-B in rat adrenal. Endocrine Research 21 267–274.[Medline]

LeHoux JG & Lefebvre A 1998 Transcriptional activity of the hamster CYP11B2 promoter in NCI-H295 cells stimulated by angiotensin II, potassium, forskolin and bisindolylmaleimide. Journal of Molecular Endocrinology 20 183–191.[Abstract]

LeHoux JG & Lefebvre A 2004 On the control of the hCYP11B2 gene expressing cytochrome P450 aldosterone synthase. Endocrine Research 30 807–812.[Medline]

LeHoux JG, Mason JI & Ducharme L 1992 In vivo effects of adrenocorticotropin on hamster adrenal steroidogenic enzymes. Endocrinology 131 1874–1882.[Abstract/Free Full Text]

LeHoux JG, Bernard H, Ducharme L, Lefebvre A, Shapcott D, Tremblay A & Véronneau S 1996a The regulation of the formation of glucocorticoids and mineralocorticoids in vivo. In Advances in Molecular and Cell Biology, pp 149–201. Eds EE Bittar, CR Jefcoate. Greenwich, CT: Jai Press Inc.

LeHoux JG, Lefebvre A, Ducharme L, LeHoux J, Martel D & Briere N 1996b Some effects of a low sodium intake on the expression of P450 aldosterone synthase in the hamster adrenal cortex: immunoblotting, immunofluorescent and immuno-gold electron microscopic studies. Journal of Endocrinology 149 341–349.[Abstract/Free Full Text]

LeHoux JG, Dupuis G & Lefebvre A 2000 Regulation of CYP11B2 gene expression by protein kinase C. Endocrine Research 26 1027–1031.[Medline]

LeHoux JG, Dupuis G & Lefebvre A 2001 Control of CYP11B2 gene expression through differential regulation of its promoter by atypical and conventional protein kinase C isoforms. Journal of Biological Chemistry 276 8021–8028.[Abstract/Free Full Text]

Li J, Feltzer RE, Dawson KL, Hudson EA & Clark BJ 2003 Janus kinase 2 and calcium are required for angiotensin II-dependent activation of steroidogenic acute regulatory protein transcription in H295R human adrenocortical cells. Journal of Biological Chemistry 278 52355–52362.[Abstract/Free Full Text]

McNeill H, Puddefoot JR & Vinson GP 1998 MAP kinase in the rat adrenal gland. Endocrine Research 24 373–380.[Web of Science][Medline]

Mellor H & Parker PJ 1998 The extended protein kinase C superfamily. Biochemistry Journal 332 281–292.[Web of Science][Medline]

Natarajan R, Dunn WD, Stern N & Nadler J 1990 Key role of diacylglycerol-mediated 12-lipoxygenase product formation in angiotensin II-induced aldosterone synthesis. Molecular and Cellular Endocrinology 72 73–80.[CrossRef][Web of Science][Medline]

Natarajan R, Lanting L, Xu L & Nadler J 1994 Role of specific isoforms of protein kinase C in angiotensin II and lipoxygenase action in rat adrenal glomerulosa cells. Molecular and Cellular Endocrinology 101 59–66.[CrossRef][Web of Science][Medline]

Natarajan R, Yang DC, Lanting L & Nadler JL 2002 Key role of P38 mitogen-activated protein kinase and the lipoxygenase pathway in angiotensin II actions in H295R adrenocortical cells. Endocrine 18 295–301.[CrossRef][Web of Science][Medline]

Naville D, Bordet E, Berthelon MC, Durand P & Begeot M 2001 Activator protein-1 is necessary for angiotensin-II stimulation of human adrenocorticotropin receptor gene transcription. European Journal of Biochemistry 268 1802–1810.[Web of Science][Medline]

Ni CW, Wang DL, Lien SC, Cheng JJ, Chao YJ & Hsieh HJ 2003 Activation of PKC-epsilon and ERK1/2 participates in shear-induced endothelial MCP-1 expression that is repressed by nitric oxide. Journal of Cell Physiology 195 428–434.[CrossRef][Web of Science][Medline]

Osman H, Murigande C, Nadakal A & Capponi AM 2002 Repression of DAX-1 and induction of SF-1 expression. Two mechanisms contributing to the activation of aldosterone biosynthesis in adrenal glomerulosa cells. Journal of Biological Chemistry 277 41259–41267.[Abstract/Free Full Text]

Parekh DB, Ziegler W & Parker PJ 2000 Multiple pathways control protein kinase C phosphorylation. EMBO Journal 19 496–503.[CrossRef][Web of Science][Medline]

Pascoe L, Jeunemaitre X, Lebrethon MC, Curnow KM, Gomez-Sanchez CE, Gasc JM, Saez JM & Corvol P 1995 Glucocorticoid-suppressible hyperaldosteronism and adrenal tumors occurring in a single French pedigree. Journal of Clinical Investigations 96 2236–2246.[Web of Science][Medline]

Pears CJ, Kour G, House C, Kemp BE & Parker PJ 1990 Mutagenesis of the pseudosubstrate site of protein kinase C leads to activation. European Journal of Biochemistry 194 89–94.[Web of Science][Medline]

Poole AW, Pula G, Hers I, Crosby D & Jones ML 2004 PKC-interacting proteins: from function to pharmacology. Trends in Pharmacological Science 25 528–535.[CrossRef][Medline]

Rainey WE & Mrotek JJ 1998 Human adrenocortical cell lines: model systems to study steroid hormone synthesis. In Human Cell Culture, Human Cancer Cell Lines. Ed. J Masters. Dordrecht: Kluwer Academic Press 1 123–135.

Rainey WE, Bird IM & Mason JI 1994 The NCI-H295 cell line: a pluripotent model for human adrenocortical studies. Molecular and Cellular Endocrinology 100 45–50.[CrossRef][Web of Science][Medline]

Rao VU, Shiraishi H & McDermott PJ 2004 PKC-epsilon regulation of extracellular signal-regulated kinase: a potential role in phenylephrine-induced cardiocyte growth. American Journal of Physiology, Heart Circulation Physiology 286 H2195–H2203.

Reyland ME 1993 Protein kinase C is a tonic negative regulator of steroidogenesis and steroid hydroxylase gene expression in Y1 adrenal cells and functions independently of protein kinase A. Molecular Endocrinology 7 1021–1030.[Abstract/Free Full Text]

Sarazin P, Lefebvre A & LeHoux JG 1998 The role of calcium channels in hamster CYP11B2 gene expression. Endocrine Research 24 633–636.[Medline]

Schreiber E, Matthias P, Muller MM & Schaffner W 1989 Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Research 17 6419.[Free Full Text]

Shaulian E & Karin M 2001 AP-1 in cell proliferation and survival. Oncogene 20 2390–2400.[CrossRef][Web of Science][Medline]

Smith RD, Baukal AJ, Dent P & Catt KJ 1999 Raf-1 kinase activation by angiotensin II in adrenal glomerulosa cells: roles of Gi, phosphatidylinositol 3-kinase, and Ca2+ influx. Endocrinology 140 1385–1391.[Abstract/Free Full Text]

Spät A & Hunyady L 2004 Control of aldosterone secretion: a model for convergence in cellular signaling pathways. Physiological Reviews 84 489–539.[Abstract/Free Full Text]

Staels B, Hum DW & Miller WL 1993 Regulation of steroidogenesis in NCI-H295 cells: a cellular model of the human fetal adrenal. Molecular Endocrinology 7 423–433.[Abstract/Free Full Text]

Strait JB 3rd, Martin JL, Bayer A, Mestril R, Eble DM & Samarel AM 2001 Role of protein kinase C-epsilon in hypertrophy of cultured neonatal rat ventricular myocytes. American Journal of Physiology, Heart Circulation Physiology 280 H756–H766.

Suzuki J, Otsuka F, Inagaki K, Takeda M, Ogura T & Makino H 2004 Novel action of activin and bone morphogenetic protein in regulating aldosterone production by human adrenocortical cells. Endocrinology 145 639–649.[Abstract/Free Full Text]

Tian Y, Smith RD, Balla T & Catt KJ 1998 Angiotensin II activates mitogen-activated protein kinase via protein kinase C and Ras/Raf-1 kinase in bovine adrenal glomerulosa cells. Endocrinology 139 1801–1809.[Abstract/Free Full Text]

Watanabe G, Lee RJ, Albanese C, Rainey WE, Batlle D & Pestell RG 1996 Angiotensin II activation of cyclin D1-dependent kinase activity. Journal of Biological Chemistry 271 22570–22577.[Abstract/Free Full Text]

Yan S & Wenner CE 2001 Modulation of cyclin D1 and its signaling components by the phorbol ester TPA and the tyrosine phosphatase inhibitor vanadate. Journal of Cell Physiology 186 338–349.[CrossRef][Medline]

Received 14 October 2005
Accepted 9 November 2005
Made available online as an Accepted Preprint 30 November 2005




This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
E. F Nogueira, Y. Xing, C. A V Morris, and W. E Rainey
Role of angiotensin II-induced rapid response genes in the regulation of enzymes needed for aldosterone synthesis
J. Mol. Endocrinol., April 1, 2009; 42(4): 319 - 330.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
D. G Romero, M. Y. Zhou, L. L Yanes, M. W Plonczynski, T. R Washington, C. E Gomez-Sanchez, and E. P Gomez-Sanchez
Regulators of G-protein signaling 4 in adrenal gland: localization, regulation, and role in aldosterone secretion
J. Endocrinol., August 1, 2007; 194(2): 429 - 440.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. G. Romero, B. L. Welsh, E. P. Gomez-Sanchez, L. L. Yanes, S. Rilli, and C. E. Gomez-Sanchez
Angiotensin II-Mediated Protein Kinase D Activation Stimulates Aldosterone and Cortisol Secretion in H295R Human Adrenocortical Cells
Endocrinology, December 1, 2006; 147(12): 6046 - 6055.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by LeHoux, J.-G.
Right arrow Articles by Lefebvre, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by LeHoux, J.-G.
Right arrow Articles by Lefebvre, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS