|
|
||||||||
Department of Neuroendocrinology, Institute of Basic Medical Sciences, University of Tsukuba, 1-11 Tennoudai, Tsukuba, Ibaraki 305-8575, Japan
1 Department of Anatomy, School of Medicine, Keio University, Tokyo 160-8582, Japan
(Requests for offprints should be addressed to H Nogami; Email: hnogami{at}md.tsukuba.ac.jp)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The expression of the growth hormone-releasing hormone (GHRH)-receptor is regulated by a number of hormonal or non-hormonal signals such as thyroid hormones (Miki et al. 1995, Korytko & Cuttler 1997), glucocorticoids (Seifert et al. 1985a,b, Lam et al. 1996, Miller & Mayo 1997a, Nogami et al. 1999), GHRH (Horikawa et al. 1996, Aleppo et al. 1997, Miller & Mayo 1997b), retinoic acids (Nogami et al. 2000) and estrogens (Lam et al. 1996). Within these factors, glucocorticoids are of particular importance, because they trigger the onset of GHRH-receptor expression in the developing pituitary gland (Nogami et al. 1999), which establishes functional correlation between brain and pituitary GH cells. In a previous study, we identified two GREs, a thyroid hormone response element (TRE) and a binding site for pit-1, a pituitary specific transcription factor (Bodner et al. 1988, Ingraham et al. 1988), in the upstream region of the rat GHRH-receptor gene (Nogami et al. 2002). Pit-1 plays a principal role in the cell type specification of prolactin (PRL), growth hormone (GH) and a subset of thyroid stimulating hormone (TSH) cells, and is a prerequisite for the transcriptional activation of the genes that are specifically expressed in these cells (Bodner et al. 1988, Ingraham et al. 1988), including GHRH-receptor gene (Lin et al. 1992, Iguchi et al. 1999, Miller et al. 1999, Nogami et al. 2002). However, pit-1 alone may not be able to induce expression of pituitary-specific genes. Several lines of evidence suggest this for example, GHFT1 cells, a clonal cell line of pituitary progenitor that express pit-1 do not express any pituitary-specific genes other than pit-1 (Lew et al. 1993). The role of pit-1 in the cell type-specific expression of a gene is, therefore, likely to be to permit the induction of the gene expression by an extracellular signal such as hormones or cytokines. The details of this mechanism are mostly unknown.
In this study, we examined the functions of each GRE and the pit-1 element in the transcriptional activation of the rat GHRH-receptor gene and the results suggest the presence of a negative regulatory element in the promoter region of this gene. It is conceivable that there is some protein interacting with this element that inhibits GR-dependent gene transcription in the absence of pit-1, and pit-1 probably excludes the inhibitory effects of this protein to permit glucocorticoid to activate gene transcription.
| Materials and methods |
|---|
|
|
|---|
The expression plasmid for the rat GR, pit-1, and thyroid hormone receptor (TR) ß2 have been described previously (Nogami et al. 2002). The expression plasmid for retinoic acid receptor (RXR)
was a gift from Dr Goda (Department of Nutrition, School of Food and Nutritional Sciences, University of Shizuoka, Shizuoka, Japan). The expression plasmid for CCAAT-enhancer binding protein (C/EBP) ß (NFIL6 (Akira et al. 1990)) was obtained from Riken BRC DNA Bank, Ibaraki, Japan. The reporter construct prGHRH-R-125/+95-luc was a pGL2 (Promega, Madison, WI, USA)-based plasmid carrying a 220 base pair promoter fragment (from +95 to 125, relative to the transcription start site; Nogami et al. 2002). The promoter of the herpes simplex virus thymidine kinase (from +29 to l107; tk) was PCR amplified and cloned into the BglII and HindIII sites of pGL3-basic plasmid (Promega) to generate the pGL3-tk plasmid. The promoter fragment from l115 to l40 of the rat GHRH-receptor gene (Fig. 1A
), a minimal fragment that encompasses two GREs (distal GRE (dGRE) and proximal GRE (pGRE)), a TRE and a pit-1 site, was PCR amplified using primer A (5'-AACCCCTGCTGAGGACACAG-3') and primer B (5'-GGGCATCTGAATATTGAAC-3') by a standard procedure. The PCR product was cloned in a pCR2.1 plasmid (Invitrogen, Carlsbad, CA, USA) and the fragment cut out by KpnI and XhoI was ligated into the pGL3-tk to make a dGpG-p construct. Similarly, the fragments containing pGRE and pit-1 or dGRE and pGRE were prepared by PCR and cloned into pGL3-tk to make pG-p or dGpG plasmid respectively. The fragment with the dGRE and pit-1 site was generated by annealing an oligonucleotide containing dGRE sequences (5'-CTGCTGAGGACACAGAGTCCC-3', dGRE sequence is underlined) with an oligonucleotide carrying the pit-1 sequence (5'-GCTGAATATTGA ACAGAAATGGGACTCTGT-3', pit-1 consensus is underlined), and filling in by Taq polymerase (Takara Shuzo, Shiga, Japan). The resultant fragment was transferred to pGL3-tk to make the dG-p plasmid. Pairs of sense and antisense strands of oligonucleotides spanning dGRE, pGRE or pit-1 elements were annealed and the resultant double stranded DNA fragments were placed upstream of the tk promoter to generate dG, pG and p plasmids respectively. Partial deletion or insertion of the sequences between the pGRE and pit-1 sites in the dGpG-p plasmid was achieved by generating a mutated PCR fragment using primer A and downstream primers with mutations (see Fig. 5
). The PCR fragments with 3- or 7-base pair deletions or a 7-base pair insertion were cloned in pGL3-tk to make dGpG
3p, dGpG
7p and dGpG+7p respectively. Primers with mutations 5'-G CTGAATA TTGAACCTACGTCAGGGACATT-3' (mutated sequences are underlined and the pit-1 site is boxed) or 5'-G CTGACTC TTGAACAGGATGGTGG GACATT-3' (mutated sequences are underlined and the pit-1 site is boxed) was used to introduce mutations into 3'-flanking sequences of the pGRE or pit-1 site respectively. The PCR fragment obtained by primer A and one of these was placed upstream of the tk promoter to generate dGpGmp or dGpG-pm respectively. Similarly, the primers carrying pit-1 sequences of the rat GH gene (rGH-2, Andersen & Rosenfeld 1994, 5'-CTGATGG ATAATTTAAAGGATGGTGGGACATT-3'), the rat prolactin gene (rPrl-1P, Andersen & Rosenfeld 1994, 5'-CATGAATATATATATAAATGGTGGGACATT-3') and the human GHRH-receptor gene (hGHRHR-P2, Iguchi et al. 1999, 5'-CGCTGAATATTCACCAGGAT GGTGGGACATT-3') were used to generate dGpG-GHp, dGpG-PRLp and dGpG-hGHRHRp respectively (see Fig. 6
). The replacement of binding sequences of C/EBP for the pit-1 element was achieved by using an antisense primer, 5'-GGATTGCGCAATCCAGGATG GTGGGACATT-3' (C/EBP consensus is underlined). Conversion of two GREs in the dGpG-p plasmid to a consensus GRE (cGRE, GGTACAnnnTGTTCT) was achieved by annealing the following two oligonucleotides; sense, 5'-GGTACACAGTGTTCTATTTGGGG CTGGCAGGTACACAATG, and antisense, 5'- CTGAATA TTGAACAGGATGGTAGAACATTGTGTACC TGCC (GRE consensus is underlined and the pit-1 consensus is boxed), filling in and cloned in pGL3-tk (cGcG-p). Similarly, pairs of oligonucleotides 5'-GGTACAAAATGTTCTGG and 5'-G CTGAATA TTGAA CAGGATGCCAGAACATTTT, or GGTACACAGTGTTCTATTTGGGGCTGGC and AGAACATTGTGTACCTGCCA (consensus for pit-1 was boxed and for GRE was underlined) were used to generate cG-p or cGcG plasmids respectively. All constructs were sequenced by the method of Sanger et al.(1977) prior to the transfection experiments.
|
|
|
The rat GH cell line, MtT/S (Inoue et al. 1990) and Cos-7 cells, a kidney fibroblast cell line from African green monkey, were maintained in DMEM/F12 medium containing 10% horse serum, 2.5% fetal bovine serum (Gibco-BRL, Rockville, MD, USA) and antibiotics (control medium). For the transfection studies, cells (5 x 104 cells/well) were grown in a 48-well plate with 0.3 ml control medium for 24 h and on the day of the experiment, the medium was replaced with serum-free Opti-MEM medium (Gibco-BRL). The plasmids were introduced into the cells by a lipofection reagent (Lipofectamine 2000, Gibco-BRL). The amount of the plasmid used per well was 500 ng for reporter constructs, 10 ng for GR, 30 ng for pit-1, 100 ng for TRß2 and RXR
. The doses of the expression plasmids were determined through preliminary experiments to be the smallest doses that induce a maximal effect, but do not induce non-specific activation of the reporter gene in pGL3 or pGL3-tk. The phRL-CMV (10 ng, Promega) was used to monitor the efficacy of transfection. The transfection was carried out in a serum-free Opti-MEM overnight, and then the medium was replaced with fresh serum-free Opti-MEM with or without hormones (dexamethasone (DEX) 100 nM and/or triiodothyronine (T3) 1 nM), followed by an additional 24-h incubation. After incubation, luciferase activity of the cell lysate was determined using a dual-luciferase reporter assay system (Promega). The luciferase activity derived from the reporter construct was normalized for that of Renilla luciferase of phRL-CMV co-transfected for internal standard, and expressed as percent of Renilla luciferase activity.
Statistical analyses
The data are expressed as means ± S.E.M. of 35 independent experiments each carried out in triplicate, and the significance of difference was determined by Students t-test or a one-way analysis of variance (ANOVA) followed by Fishers protected least significant difference (PLSD) test.
| Results |
|---|
|
|
|---|
(100 ng) and pit-1 (30 ng) were co-transfected, DEX induced the reporter gene expression from prGHRH-R-125/+95-Luc as well as in MtT/S cells (Fig. 1D
, and pit-1 (2.7-fold increase by T3, P<0.05 vs without T3 by Students t-test, n=3). The basal activity of GHRH-R-125/+95-Luc in Cos-7 cells did not show any significant increase with the expression of GR, TRß2, RXR
or pit-1 (Fig. 1D
In order to elucidate the role of GR and pit-1 in rat GHRH-receptor gene transcription, we examined the enhancer activity of two GREs and the pit-1 binding site of this gene, using heterologous thymidine kinase promoter and Cos-7 cells. First, the effects of transfection of the expression plasmid for pit-1 and GR on the basal activity of pGL3 basic or pGL3-tk plasmid were examined (Fig. 2A and B
). Up to 100 ng GR or pit-1 expression plasmid did not affect reporter gene expression from pGL3 (Fig. 2A
). Transcription of reporter gene from pGL3-tk was also not affected by GR but was significantly enhanced by 100 ng pit-1 expression plasmid (Fig. 2B
).
|
When dGpG-p with two GREs and a pit-1 site (Fig. 3A
) was transfected to Cos-7 cells in conjunction with expression plasmids for pit-1 and GR, the reporter gene expression from this construct was enhanced by DEX by about 6.6-fold (Fig. 3B
, bottom panel). However, interestingly, this construct showed minimal response to DEX without pit-1 (1.6-fold, Fig. 3B
, top panel). This latter finding apparently conflicts with the results of Fig. 2
that the transcription from dGpG with no pit-1 site responded to DEX by 4.4-fold (Fig. 2
), while it coincides well with previous results that showed that the transcription of the GHRH-receptor gene requires pit-1 (Lin et al. 1992, Iguchi et al. 1999, Miller et al. 1999, Nogami et al. 2002). The only explanation possible for this discrepancy is that some DNA sequences within dGpG-p that are absent in dGpG, the pit-1 site and the 14-base pair spacer between pGRE and the pit-1 site, contain the silencer element. Since GRE-pit-1 constructs (dG-p or pG-p in Fig. 3
) did not react to DEX, this suggests that two GREs are necessary for the synergy of glucocorticoids and pit-1. A single consensus GRE-pit-1 construct (cG-p) also weakly responded to DEX in the presence of pit-1. On the other hand, the construct with two cGREs (cGcG-p) showed about a 12.8-fold increase in reporter expression in response to DEX in the presence of pit-1. Unlike the dGpG-p, transcription from cGcG-p increased in response to DEX by about 7.2-fold without pit-1 (Fig. 3B
), although this construct contains a putative silencer element (Fig. 3A
).
|
3p and dGpG
7p in Fig. 5
|
In order to ascertain whether or not other classes of transcription factor can replace pit-1, the pit-1 element of dGpG-p was replaced by the consensus C/EBP binding site to make dGpG-cebp (Fig. 7
). This construct responded to DEX treatment without co-transfection of C/EBPß or pit-1 expression plasmid, probably because the pit-1 binding site was eliminated. Pit-1 expression did not affect the glucocorticoid responsiveness of this construct but additional expression of C/EBPß (NFIL6) enhanced the glucocorticoid effect by about 2.5-fold. The expression of C/EBPß did not induce glucocorticoid-dependent transcription of reporter gene in dGpG-p.
|
| Discussion |
|---|
|
|
|---|
The results shown in Figs 2
and 3
suggest that 21-base pair sequences 3' to the pGRE (this region contains the pit-1 site) are responsible for silencing transcription driven by the combined two GREs in the rat GHRH-receptor gene. The mutation of the pit-1 element (dGpG-pm in Fig. 4
) resulted in pit-1-independent reporter gene expression by DEX to a level similar to that of the dGpG plasmid in which the entire silencer element was eliminated. These results suggest that the pit-1 site is the principal part of the silencer element; however, the 7-base pair sequence next to the pGRE also appears to be involved in the silencer element because mutation (dGpGmp in Fig. 4
) or deletion (dGpG
7 in Fig. 5
) of this sequence resulted in the pit-1-independent DEX induction of reporter. Thus a putative silencer element encompasses the 21-base pair sequences from the the 3'-end of the pGRE to the pit-1 consensus.
It is possible that the binding of a certain protein to this silencer element blocks the binding of GR to neighboring pGRE. Since binding of GRs to both GREs is required for the glucocorticoid action (Fig. 2
), probably because of co-operative binding of receptors to adjacent GREs as demonstrated previously (Schmid et al. 1989, Tsai et al. 1989), inhibition of GR binding to pGRE alone by a silencer protein should result in a significant negative effect on gene transcription. It is also likely that the silencer protein does not interfere with the binding of GR to GREs, but inhibits the formation of the complex of DNA-bound GRs and various other classes of nuclear proteins. The DNA-bound GRs have been shown to bind nuclear coactivators such as GRIP1 (Hong et al. 1996), and further recruitment of modulators that have histone acetylase or methylase activity is proposed to be required for glucocorticoid-dependent gene transcription. In the presence of pit-1, such as in pit-1-expressing cells, preferential binding of pit-1 to its element probably removes the silencer protein to allow GRs to interact with pGRE, or the formation of the complex of GRs and other nuclear proteins, leading to the activation of the transcription.
The synergistic activation of the reporter gene expression by DEX and pit-1 was seen in dGpGmp (Fig. 4
), but not in dGpG
7p or in dGpG+7p (Fig. 5
). These results indicate that the distance between pGRE and the pit-1 site is critical, suggesting that a physical interaction between GR and pit-1 may be involved in the mechanism responsible for this synergy. Our results also suggest that the synergy is not an intrinsic function of GREs and the pit-1 element of the rat GHRH-receptor promoter, because the replacement of consensus GRE for both dGRE and pGRE or other pit-1 elements for that of dGpG-p did not abolish the synergy (Fig. 6
).
Little is known about the mechanisms of the synergy of nuclear hormone receptors and pit-1, despite the fact that the synergy may explain why a hormone could regulate a particular gene expression in a cell-specific manner. In the rat prolactin gene, the transcription of which is highly dependent on estrogen, a binding site for estrogen receptor is located near one of the binding sites for pit-1 (1D-site) in the distal enhancer region (Kim et al. 1988). Although this estrogen response element (ERE) is weak and non-consensus, the binding of pit-1 to the 1D-site enables estrogens to regulate PRL gene transcription through this ERE in the pituitary PRL cells (Nowakowski & Maurer 1994). The role of pit-1 in the rat prolactin promoter appears different from that in the rat GHRH-receptor gene, because the 1D pit-1 site of the rat PRL gene promoter cannot be replaced by other classes of transcription factor binding sites (Nowakowski & Maurer 1994), while that of the GHRH-receptor promoter can be replaced by the binding site for C/EBP (Fig. 7
). The physical association of the receptors for T3 and retinoic acid and pit-1 is reported to be involved in the synergistic activation of the rat GH transcription (Palomino et al. 1998). However, in the activation of the PRL gene, the interaction of pit-1 and estrogen receptors has not been demonstrated (Nowakowski & Maurer 1994). As discussed above, the physical interaction of GRs and pit-1 is likely to be involved in the rat GHRH-receptor gene transcription. However, our mammalian two-hybrid assay failed in demonstrating interaction of GR and pit-1, suggesting either that the physical interaction of these two may not be involved in the rat GHRH-receptor transcription, or that the interaction is too weak to be detected with our system (data not shown).
In conclusion, the present results suggest that the roles of pit-1 in rat GHRH receptor gene transcription is to eliminate the inhibitory effects of a silencer on GREs, and to synergize with GRs, the latter being dependent on the distance between pGRE and the pit-1 binding site. The nature of the protein(s) that binds to the presumptive silencer region is currently unknown. Since Cos-7 cells, kidney fibroblasts, express this protein, it is likely that the protein is expressed ubiquitously. Identification of the silencer protein is required for the further elucidation of the molecular mechanisms of the cell-specific activation of GHRH-receptor gene transcription by glucocorticoids.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Aleppo G, Moskal SF, De Grandis PA, Kineman RD & Frohman LA 1997 Homologous down-regulation of growth hormone-releasing hormone receptor messenger ribonucleic acid levels. Endocrinology 138 10581065.
Andersen B & Rosenfeld MG 1994 Pit-1 determines cell type during development of the anterior pituitary gland. A model for transcriptional regulation of cell phenotypes in mammalian organogenesis. Journal of Biological Chemistry 269 2933529338.
Andersen B & Rosenfeld MG 2001 POU domain factors in the neuroendocrine system: lessons from developmental biology provide insights into human disease. Endocrine Reviews 22 235.
Becker PB, Gloss B, Schmid W, Strahle U & Schutz G 1986 In vivo proteinDNA interactions in a glucocorticoid response element require the presence of the hormone. Nature 324 686688.[CrossRef][Medline]
Bodner M, Castrillo JL, Theill LE, Deerinck T, Ellisman M & Karin M 1988 The pituitary-specific transcription factor GHF-1 is a homeobox-containing protein. Cell 55 505518.[CrossRef][Web of Science][Medline]
Hong H, Kohli K, Trivedi A, Johnson DL & Stallcup MR 1996 GRIP1, a novel mouse protein that serves as a transcriptional coactivator in yeast for the hormone binding domains of steroid receptors. PNAS 93 49484952.
Horikawa R, Hellmann P, Cella SG, Torsello A, Day RN, Muller EE & Thorner MO 1996 Growth hormone-releasing factor (GRF) regulates expression of its own receptor. Endocrinology 137 26422645.[Abstract]
Iguchi G, Okimura Y, Takahashi T, Mizuno I, Fumoto M, Takahashi Y, Kaji H, Abe H & Chihara K 1999 Cloning and characterization of the 5'-flanking region of the human growth hormone-releasing hormone receptor gene. Journal of Biological Chemistry 274 1210812114.
Ingraham HA, Chen RP, Mangalam HJ, Elsholtz HP, Flynn SE, Lin CR, Simmons DM, Swanson L & Rosenfeld MG 1988 A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype. Cell 55 519529.[CrossRef][Web of Science][Medline]
Inoue K, Hattori MA, Sakai T, Inukai S, Fujimoto N & Ito A 1990 Establishment of a series of pituitary clonal cell lines differing in morphology, hormone secretion, and response to estrogen. Endocrinology 126 23132320.
Kim KE, Day RN & Maurer RA 1988 Functional analysis of the interaction of a tissue-specific factor with an upstream enhancer element of the rat prolactin gene. Molecular Endocrinology 2 13741381.
Korytko AI & Cuttler L 1997 Thyroid hormone and glucocorticoid regulation of pituitary growth hormone-releasing hormone receptor gene expression. Journal of Endocrinology 152 R13R17.
Lam KSL, Lee MF, Tam SP & Srivastava G 1996 Gene expression of the receptor for growth-hormone-releasing hormone is physiologically regulated by glucocorticoids and estrogen. Neuroendocrinology 63 475480.[Web of Science][Medline]
Lew D, Brady H, Klausing K, Yaginuma K, Theill LE, Stauber C, Karin M & Mellon PL 1993 GHF-1-promoter-targeted immortalization of a somatotropic progenitor cell results in dwarfism in transgenic mice. Genes and Development 7 683693.
Lin C, Lin SC, Chang CP & Rosenfeld MG 1992 Pit-1 dependent expression of the receptor for growth hormone releasing factor mediates pituitary cell growth. Nature 360 765768.[CrossRef][Medline]
Miki N, Ono M, Murata Y, Ohsaki E, Tamitsu K, Ri T, Demura H & Yamada M 1995 Thyroid hormone regulation of gene expression of the pituitary growth hormone-releasing factor receptor. Biochemical and Biophysical Research Communications 217 10871093.[CrossRef][Web of Science][Medline]
Miller T & Mayo K 1997a Glucocorticoids regulate pituitary growth hormone-releasing hormone receptor messenger ribonucleic acid expression. Endocrinology 138 24582465.
Miller TL & Mayo KE 1997b Growth hormone-releasing hormone (GHRH) receptor mRNA regulation in rat pituitary cells. Program of the 79th Annual Meeting of the Endocrine Society, Minneapolis, MN, P179 (Abstract).
Miller TL, Godfrey PA, Dealmeida VI & Mayo KE 1999 The rat growth hormone-releasing hormone receptor gene: structure, regulation, and generation of receptor isoforms with different signaling properties. Endocrinology 140 41524165.
Nogami H, Inoue K, Moriya H, Ishida A, Kobayashi S, Hisano S, Katayama M & Kawamura K 1999 Regulation of growth hormone-releasing hormone receptor mRNA expression by glucocorticoids in MtT-S cells and in the pituitary gland of fetal rats. Endocrinology 140 27632780.
Nogami H, Matsubara M, Harigaya T, Katayama M & Kawamura K 2000 Retinoic acids and thyroid hormone act synergistically with dexamethasone to increase growth hormone-releasing hormone receptor mRNA expression. Endocrinology 141 43964401.
Nogami H, Hiraoka Y, Matsubara M, Nonobe E, Harigaya T, Katayama M, Hemmi N, Kobayashi S, Mogi K, Aiso S, Kawamura K & Hisano S 2002 A composite hormone response element regulates transcription of the rat GHRH receptor gene. Endocrinology 143 13181326.
Nowakowski BE & Maurer RA 1994 Multiple Pit-1-binding sites facilitate estrogen responsiveness of the prolactin gene. Molecular Endocrinology 8 17421749.
Palomino T, Sanchez-Pacheco A, Pena P & Aranda A 1998 A direct proteinprotein interaction is involved in the cooperation between thyroid hormone and retinoic acid receptors and the transcription factor GHF-1. FASEB Journal 12 12011209.
Sanger F, Nicklen S & Coulson AR 1977 DNA sequencing with chain-terminating inhibitors. PNAS 74 54635467.
Schmid W, Strahle U, Schutz G, Schmitt J & Stunnenberg H 1989 Glucocorticoid receptor binds cooperatively to adjacent recognition sites. EMBO Journal 8 22572263.[Web of Science][Medline]
Schule R, Muller M, Kaltschmidt C & Renkawitz R 1988 Many transcription factors interact synergistically with steroid receptors. Science 242 14181420.
Seifert H, Perrin M, Rivier J & Vale W 1985a Binding sites for growth hormone releasing factor on rat anterior pituitary cells. Nature 313 487489.[CrossRef][Medline]
Seifert H, Perrin M, Rivier J & Vale W 1985b Growth hormone-releasing factor binding sites in rat anterior pituitary membrane homogenates: modulation by glucocorticoids. Endocrinology 117 424426.
Suh DS & Rechler MM 1997 Hepatocyte nuclear factor 1 and the glucocorticoid receptor synergistically activate transcription of the rat insulin-like growth factor binding protein-1 gene. Molecular Endocrinology 11 18221831.
Truss M & Beato M 1993 Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors. Endocrine Reviews 14 459479.
Tsai SY, Tsai MJ & OMalley BW 1989 Cooperative binding of steroid hormone receptors contributes to transcriptional synergism at target enhancer elements. Cell 57 443448.[CrossRef][Web of Science][Medline]
Received 5 September 2005
Accepted 20 September 2005
Made available online as an Accepted Preprint 4 October 2005
This article has been cited by other articles:
![]() |
A. T. McElvaine, A. I. Korytko, S. M. Kilen, L. Cuttler, and K. E. Mayo Pituitary-Specific Expression and Pit-1 Regulation of the Rat Growth Hormone-Releasing Hormone Receptor Gene Mol. Endocrinol., August 1, 2007; 21(8): 1969 - 1983. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Y. Kwok, Y. Wang, C. Y. Wang, and F. C. Leung Cloning of Chicken Glucocorticoid Receptor (GR) and Characterization of its Expression in Pituitary and Extrapituitary Tissues Poult. Sci., February 1, 2007; 86(2): 423 - 430. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |