|
|
||||||||
Division of Reproductive Endocrinology, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, Dallas, TX 75390-9032, USA
1 Division of Endocrinology, Diabetes, and Hypertension, Department of Medicine, Brigham and Womens Hospital, Harvard Medical School, Boston, MA 02115, USA
2 Department of Obstetrics and Gynecology, TuftsNew England Medical Center, Boston, MA 02111, USA
(Requests for offprints should be addressed to Lisa M Halvorson; Email: Lisa.Halvorson{at}UTSouthwestern.edu)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
-subunit linked non-covalently to one of two unique ß-subunits (LHß and FSHß, respectively). These ß-subunits provide the functional specificity that distinguishes LH from FSH via interactions with distinct G-protein-coupled receptors. Biosynthesis of the ß-subunits is believed to be the rate-limiting step in the generation of physiologically active heterodimers. Over the past decade, substantial progress has been made in the identification of the transcription factors which are required for basal, tissue-specific, and gonadotropin-releasing hormone (GnRH)-activated expression of the LHß-subunit gene, including steroidogenic factor-1 (SF-1), early growth response gene 1 (Egr-1) and Sp1 (Halvorson et al. 1996, 1998, Keri & Nilson 1996, Parker et al. 1996, Wolfe 1999, Kaiser et al. 2000, Zhao et al. 2001). More recent investigations have demonstrated a critical role for the transcription factor pituitary homeobox 1 (Pitx1) in both anterior pituitary development as well as the regulation of a broad array of pituitary-specific genes in the adult (Lamonerie et al. 1996, Lanctot et al. 1997, Drouin et al. 1998, Tremblay et al. 1998, Kurotani et al. 1999, Lanctot et al. 1999, Quirk et al. 2001, Quentien et al. 2002, Zakaria et al. 2002, Jeong et al. 2004).
Pitx1, and the closely related proteins Pitx2 and Pitx3, are members of the bicoid-related homeodomain protein family. During embryonic development, Pitx1 and Pitx2 are expressed in the epithelia of the oral cavity and the first branchial arch, structures which subsequently develop into the anterior pituitary gland, nasopharynx, palate, tongue, and olfactory and dental epithelium. In later development, Pitx1 contributes to the differentiation of anterior pituitary lineages through synergism with cell-restricted transcription factors such as SF-1 (gonadotropes), Pit1 (lactotropes and somatotropes), and bHLH NeuroD1/Pan1 (corticotropes; Szeto et al. 1999, Tremblay & Drouin 1999, Tremblay et al. 1999).
Mice homozygous for deletion of the Pitx1 gene undergo normal early pituitary organogenesis, perhaps due to the compensatory effects of Pitx2; however, subsequent pituitary development is markedly abnormal. Both mRNA and protein levels of LHß, FSHß, and thyroid-stimulating hormone (TSH) ß are substantially reduced in Pitx1-null animals with a less-marked decrease in glycoprotein
-subunit levels (Szeto et al. 1999).
Pitx1 expression persists in the adult pituitary gland. Based on analysis of pituitary-derived cell lines, Pitx1 mRNA and protein are expressed in all pituitary lineages, with particularly high expression levels in cell lines which express the glycoprotein
-subunit (i.e. gonadotropes and thyrotropes) (Tremblay et al. 1998, Kurotani et al. 1999). Within gonadotropes, Pitx1 has been demonstrated to stimulate expression of the genes that encode the
-subunit, LHß, FSHß, and GnRH receptor (Tremblay et al. 1998, Quirk et al. 2001, Zakaria et al. 2002, Jeong et al. 2004). Pitx1-mediated transactivation of the LHß gene has been shown to be enhanced in the presence of the orphan nuclear hormone receptor, SF-1, as well as Egr-1 (Tremblay et al. 1998, 1999, Quirk et al. 2001).
We were interested in investigating the effect of Pitx1 and known transcriptional partners in regulation of the rat LHß gene promoter. In early experiments, we observed persistent Pitx1-stimulated promoter activity despite mutation of the previously described Pitx1 cis-element at position 101. In the studies reported here, we identify a second region in the proximal rat LHß gene promoter which binds Pitx1 and confers Pitx1 responsiveness. Furthermore, we characterize the importance of both of these sites for synergy between Pitx1 and SF-1 or Egr-1.
| Materials and methods |
|---|
|
|
|---|
The LHß reporter constructs used for these studies contain the 5'-flanking sequence of the rat LHß gene and the first 5 bp of the 5'-untranslated region fused to a luciferase reporter gene, pXP2 (Nordeen 1988). 5' deletions were created by subcloning PCR products containing the LHß promoter sequences into the pXP2 vector using BamHI/HindIII sites that were introduced by the primers (Kaiser et al. 1998). In a subset of experiments, the LHß promoter sequence was excised using BamHI and HindIII restriction enzymes and inserted into pGL3-Basic at BglI/HindIII (Promega, Madison, WI, USA). Mutations were introduced into the LHß promoter region using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA).
The mouse Pitx1 expression vector contains the Pitx1 open reading frame subcloned into pcDNA3/Amp (Invitrogen, Carlsbad, CA, USA; kindly provided by U B Kaiser, Brigham and Womens Hospital, Boston, MA, USA; Jeong et al. 2004). The SF-1 expression vector contains 2.1 kb of the mouse SF-1 cDNA driven by the cytomegalovirus (CMV) promoter in the vector pCMV5 (provided by K L Parker, Southwestern University School of Medicine, Dallas, TX, USA; Lala et al. 1992).
Transient transfection of cell lines
Green monkey kidney fibroblasts (CV-1) and mouse gonadotrope-derived cells (LßT2 and AT31) were maintained in monolayer culture in low-glucose (CV-1) or high-glucose (LßT2) Dulbeccos modified Eagles medium supplemented with 10% (v/v) certified fetal calf serum and 1% (v/v) penicillin/streptomycin at 37 °C in humidified 5% CO2/95% air. The immortalized gonadotrope cell lines were generously provided by Dr P L Mellon (University of California, San Diego, CA, USA; Windle et al. 1990, Thomas et al. 1996). Cells were transfected at 5080% confluence in 12-well plates using the calcium phosphate precipitation method (CV-1 cells) or Lipofectamine reagent (LßT2 cells; Invitrogen; Sambrook et al. 1989). Cells received 0.4 µg/well of reporter vector and 0.1 µg/well of expression vector. Co-transfection with a Rous sarcoma virus (RSV)- ß-galactosidase plasmid allowed correction for differences in transfection efficiency between wells in all experiments. Cells were harvested approximately 48 h following transfection and the cell extracts analyzed for luciferase activity and ß-galactosidase activity using the Galacto-Light assay system (Applied Biosystems, Foster City, CA, USA; Edlund et al. 1985, deWet et al. 1987). Luciferase activity was normalized to the level of ß-galactosidase activity and results calculated as fold-change relative to expression in the control wells. Data are shown as the mean ± S.E.M. from 37 independent experiments.
Electrophoretic mobility shift assay (EMSA)
The nucleotide sequence of the rat LHß gene promoter is based on sequencing data available at GenBank accession number AF020505
[GenBank]
. Double-stranded oligonucleotide probes were created by T4 polynucleotide kinase end-labeling with [
-32P]ATP followed by purification over a Quick Spin G-25 Sephadex column (Roche Applied Science, Indianapolis, IN, USA).
The following oligonucleotide sequences were utilized (substituted nucleotides underlined): (5'Pitx1) 5'-AGAG ATTAGTGTCTAGGTTACCCA-3'; (5'Pitx1 M) 5'-AGA ATTCAGTGTCTAGGTTACCCA-3'; (5'SF1-Pitx1) 5'-CTTTCTGACCTTGTCTGTCTCGCCCCCAAAGA GATTAGTGTCTA-3'; (5'SF1-Pitx1 M) 5'-CTTTCT GACCTTGTCTGTCTCGCCCCCAAAGAATTCAG TGTCTA-3'; (5'SF1 M-Pitx1) 5'-CTTTCTGAAATTGT CTGTCTCGCCCCCAAAGAGATTAGTGTCTA-3'; (5'SF1 M-Pitx1 M) 5'-CTTTCTGAAATTGTCTGTC TCGCCCCCAAAGAATTCAGTGTCTA-3'; (3'Pitx1) 5'-CCTGTAGCCTCTGCTTAGTGGCCTTGCCA C-3'; (3'Pitx1 MA) CCTGAATTCTCTGCTTAGTG GCCTTGCCAC; (3'Pitx1 MB) 5'-CTGTAGCCTCTG AATTCTGGCCTTGCCAC-3'; (3'Pitx1 MC) 5'-CCT GTAGCCTCTGCTTAGTGGAATTCCCAC-3'.
10 µg nuclear protein or 3 µg glutathione-S-transferase (GST) or GSTPitx1 were incubated with 60 000 c.p.m. oligonucleotide probe in DNA-binding buffer (20 mM Hepes (pH 7.9), 60 mM KCl, 5 mM MgCl2, 10 mM PMSF, 10 mM dithiothreitol, 1 mg/ml BSA, and 5% (v/v) glycerol). Where indicated, an excess of unlabeled oligonucleotide or 2 µl of antisera was added 20 min prior to the addition of labeled probe. ProteinDNA complexes were resolved on a 5% nondenaturing polyacrylamide gel in 0.5xTris/borate/ EDTA buffer and subjected to autoradiography.
The GSTPitx1 plasmid was generated by insertion of the Pitx1 cDNA downstream of the GST coding sequence in the pGEX-4T-2 expression vector (Amersham Biosciences Corp, Piscataway, NJ, USA) in the BamHI/NotI sites (construct provided by U B Kaiser; Jeong et al. 2004). This plasmid was introduced into a BL21 bacterial stock followed by induction with isopropyl ß-D-thiogalactosidase to induce expression of the fusion protein, which was purified on a GST-affinity column (Amersham Biosciences Corp).
Nuclear proteins were isolated using NE-PER Nuclear and Cytoplasmic Extraction Reagents and total protein concentration determined by bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL, USA). In vitro-translated SF-1 was generated from a plasmid containing 2.1 kb pairs of the mouse SF-1 cDNA (provided by Dr K L Parker) using the TNT Coupled Reticulocyte Lysate System (Promega).
The polyclonal Pitx1 antibody was generated in rabbits against a peptide corresponding to amino acids 2452 of mouse Pitx1 conjugated to keyhole limpet hemocyanin (Covance Research, Richmond, CA, USA; provided by UB Kaiser; Zakaria et al. 2002).
To provide quantitation, autoradiographs were photographed using a Kodak digital camera (DC 290) and the net density of signals was evaluated by Kodak 1D Image Analysis software (Eastman Kodak Company, Rochester, NY, USA).
Statistical analysis
Statistical calculations was performed using the SigmaStat statistical software package (SPSS Science, Chicago, IL, USA). Data were analyzed for normality followed by calculation of analysis of variance (ANOVA) or the KruskalWallis ANOVA on ranks for non-parametric data. The StudentNewmanKeuls method was utilized for post-hoc comparison, except for experiments with different sample sizes in which case Dunns test was employed. Statistical significance was set at P<0.05.
| Results |
|---|
|
|
|---|
We first analyzed the effect of Pitx1 and/or SF-1 on transactivation of the LHß gene promoter using transient transfection experiments in two cell lines, a gonadotrope-derived cell line (LßT2) and a fibroblast cell line (CV-1). Cells were transfected with a reporter construct containing region 207/+5 of the rat LHß gene promoter upstream of the luciferase reporter vector, pXP2. Cells were co-transfected with expression vectors for Pitx1 and/or SF-1. In CV-1 cells, which lack both transcription factors, LHß gene promoter activity was increased significantly with the addition of Pitx1 or SF-1 (17- and 55-fold, respectively; P<0.05 versus the empty control vector) (Fig. 1A
). The addition of both factors produced a synergistic response of over 110-fold (P<0.05 versus control and versus Pitx1 or SF-1 alone). In LßT2 cells, overexpression of Pitx1 or SF-1 modestly, but significantly, increased LHß promoter activity relative to control wells (1.8- and 2-fold, respectively; P<0.05 versus control; Fig. 1B
). Once again, a synergistic response was observed with the overexpression of both factors (7.5-fold; P<0.05 versus control and versus Pitx1 or SF-1 alone). The comparatively small magnitude of the response in the gonadotrope LßT2 cell line is likely due to the high level of endogenous Pitx1 expression reported in these cells. Therefore, in order to increase our ability to identify subtle changes in expression, we chose to continue our analysis in the CV-1 cell line.
|
We next evaluated the response to Pitx1 following deletion or mutation of the previously identified Pitx1 site (Fig. 2A
). A statistically significant residual Pitx1 response was observed in the mutated construct (7.6-fold) and in the 5' deleted constructs (3.6- and 2-fold for the 82/+5 and 68/+5 constructs, respectively; P<0.05 versus response in the empty reporter vector, pXP2). In order to confirm this observation, additional constructs were generated which contained rat LHß gene sequences in a second luciferase reporter vector, pGL3. As shown in Fig. 2B
, a residual Pitx1 response was again observed in a construct containing a mutation in the 101 Pitx1 site (2.8-fold; P<0.05 versus control). Taken together, these results suggested strongly the presence of a second functional Pitx1 cis-element in the LHß gene promoter.
|
EMSA was used to characterize the site(s) at which Pitx1 interacts with the rat LHß gene promoter. As shown in Fig. 3A
, nuclear extracts from the gonadotrope-derived
T31 cell line bound to an oligonucleotide probe which spans the 101 Pitx1 cis-element to produce a dominant band (Fig. 3A
, lane 1). Formation of this complex was effectively competed by the addition of excess cold wild-type oligonucleotide (Fig. 3A
, lane 2), but not by a mutated oligonucleotide (Fig. 3A
, lane 3) or by an unrelated oligonucleotide containing the LHß 3'Egr-1 site (Fig. 3A
, lane 4). Gonadotrope nuclear extract interacted weakly with the mutated oligonucleotide when used as a probe, demonstrating specificity of the proteinDNA interaction (Fig. 3A
, lane 5).
|
Pitx1 binds to a second proximal site in the rat LHß gene promoter
Analysis of the proximal rat LHß gene promoter sequence identified three regions with homology to the consensus Pitx1 cis-element (TAA(T/G)CC). These putative cis-elements within the 3'Pitx1 region were designated sites A, B and C (Fig. 4
). As shown in Fig. 5A
, a GSTPitx1 fusion protein bound with high affinity to the previously identified 5'Pitx1 site on EMSA (Fig. 5A
, left-hand panel). This complex was effectively super-shifted by a Pitx1-specific antibody. Pitx1 also bound specifically to an oligonucleotide probe which spans all three putative 3' Pitx1 sites in the 3'Pitx1 region (Fig. 5A
, right-hand panel).
|
|
Pitx1 was noted to produce a less-intense complex with the 3'Pitx1 probe than with the probe spanning the more distal Pitx1 cis-element. In order to estimate the relative efficiency of the Pitx1DNA interaction in these two regions, a competitive EMSA experiment was performed (Fig. 5B
). Pitx1 fusion protein was added to the oligonucleotide probe containing the 3'Pitx1 region. Increasing amounts of unlabeled 5' or 3'Pitx1 oligonucleotide were added and the intensity of the generated complex quantified. Based on results from three independent experiments, the Pitx1 binds the 5'Pitx1 site with approximately 6-fold greater affinity than the 3'Pitx1 region. This result is consistent with the relative functional importance of these two sites as assessed in transfection experiments.
Pitx1 binds with greatest intensity to site B within the putative 3'Pitx1 region of the proximal LH' gene
We next evaluated the ability of Pitx1 to bind to each of the putative 3'Pitx1 DNA-binding sites identified in the rat LHß gene promoter. Oligonucleotide probes were generated which contained mutations in each of these Pitx1 sites individually. As shown in Fig. 6A
, mutation of site B essentially eliminated the ability of Pitx1 to bind to the probe. In contrast, substantial amounts of protein binding persisted following mutation of the A or C sites. The numerical data presented are based on the cumulative results from four assays, with binding to the wild-type probe set at 100%. Of interest, binding to site A was somewhat decreased in the experiment shown in this figure, raising the possibility that it may contribute to Pitx1 effects.
|
The 3'Pitx1 region contributes to Pitx1-induced activation of the rat LHß gene
In order to test the functional importance of site B, additional luciferase reporter constructs were generated which contained mutations in this site, either alone or in conjunction with the mutated 5'Pitx1 cis-element. As shown in Fig. 7A
, mutation of site B in the 3'Pitx1 region significantly blunted the Pitx1 response in the rat LHß gene promoter, with complete loss of Pitx1-responsiveness in the presence of the double mutation.
|
We also were interested in investigating the role of each of the Pitx1 cis-elements in mediating the synergistic response with SF-1 (Fig. 7B
). The addition of both Pitx1 and SF-1 increased luciferase activity by over 100-fold in the wild-type rat LHß gene promoter. In the 5'Pitx1-mutated construct, transfection of Pitx1 and SF-1 produced a response that was greater than additive for the two factors alone (5-, 17-, and 43-fold for Pitx1, SF-1, and Pitx1+SF-1, respectively), but was diminished relative to the wild-type promoter. Mutation of the 3'Pitx1 cis-element had minimal impact on the synergistic response.
As an alternative method for analyzing the degree of synergy in the various constructs, the results were also calculated as the response to both transcription factors relative to the response to SF-1 alone. As shown in Fig. 7C
, Pitx1SF-1 synergy was decreased markedly with mutation of the 5'Pitx1 site in this series of experiments. Pitx1 augmentation of the SF-1 response was unchanged with mutation of the 3'Pitx1 site alone; however, synergy was eliminated with mutation of both Pitx1 cis-elements suggesting that the 3'Pitx1 site may play a minor role in the interaction between SF-1 and Pitx1.
The importance of the 3'Pitx1 site was also evaluated in the gonadotrope LßT2 cell line. As shown in Fig. 8
(upper panel), mutation of the putative 3'Pitx1 site blunted LHß-driven luciferase activity in LßT2 cells, although not to the extent observed with mutation of the 5' site (P<0.005 versus wild-type for all mutant constructs). This result is consistent with an inability of endogenous Pitx1 to transactivate the mutated sequences. Quirk and colleagues (2001) similarly have shown that mutation of the 5'Pitx1 element blocks activation of the bovine LHß promoter in LßT2 cells. Our interpretation of these data is further supported by equivalent analysis in Pitx1-deficient CV-1 cells in which mutation of the Pitx1 sites did not blunt basal expression (Fig. 8
, lower panel).
|
Our transfection data demonstrated that the 5'Pitx1 site is more important than the 3'Pitx1 site in conferring transcriptional synergy by Pitx1 and SF-1. We investigated whether this differential response could be explained by differences in the ability of SF-1 and Pitx1 to bind simultaneously to adjacent Pitx1 and SF-1 cis-elements.
As shown on the left-hand side of Fig. 9A
, SF-1 and Pitx1 bound independently to a probe spanning the 5'SF-1 and 5'Pitx1 cis-elements (Fig. 9A
, lanes 2 and 4, respectively). A third, larger complex was generated with the addition of both proteins together (Fig. 9A
, lane 5), suggesting concurrent binding of SF-1 and Pitx1 to this DNA region. This result cannot distinguish direct DNA binding by both factors from DNA binding by a single factor that has formed a complex with a non-DNA binding partner. To further investigate this issue, oligonucleotide probes were utilized which contained mutations in the Pitx1 region (Fig. 9A
, lanes 610), or in the SF-1 site (Fig. 9B
, lanes 15), or in both sites (Fig. 9B
, lanes 610). Mutation of the 5'Pitx1 region maintained SF-1 binding (Fig. 9A
, lane 7) but nearly eliminated Pitx1 binding (Fig. 9A
, lane 9), whereas mutation of the 5'SF-1 site had the converse effect (Fig. 9B
, lanes 2 and 4). No evidence of a higher-order complex was observed with either of the mutated probes, arguing against the ability of either SF-1 or Pitx1 to bind indirectly to the 5' region.
|
Both Pitx1 regions contribute to synergy with Egr-1 on LHß gene expression
Previous reports have demonstrated functional synergy between Pitx1 and Egr-1, an immediate early gene which is highly induced by GnRH. Our group and others have characterized two Egr-1 cis-elements in the LHß gene promoter located near the SF-1 and Pitx1 sites (Halvorson et al. 1998, 1999, Dorn et al. 1999, Tremblay & Drouin 1999, Wolfe & Call 1999). We investigated the importance of the two Pitx1 DNA-regulatory regions in conferring functional synergy using transfection experiments that paralleled those shown for Pitx1 and SF-1 in Fig. 7
. As demonstrated previously, Pitx1 and Egr-1 interact cooperatively to stimulate LHß gene promoter activity (Fig. 10A
). Next, the response to Pitx1 and Egr-1 together was evaluated in the wild-type and Pitx1 mutation constructs (Fig. 10B
). Mutation of the 5' and/or 3' Pitx1 regions significantly decreased the Pitx1Egr-1 response relative to the wild-type promoter sequence (P<0.05), consistent with a contribution by both regions to this response. Interestingly, the response to both transcription factors exceeded the response to either transcription factor alone in the double mutant construct (Fig. 10B and C
). This result suggests that Pitx1Egr-1 synergy does not require binding by Pitx1, unlike the result observed for the Pitx1SF-1 interaction.
|
| Discussion |
|---|
|
|
|---|
Our data confirmed the ability of SF-1 and Pitx1 to act independently and in synergy to stimulate LHß transcription in both gonadotrope (LßT2) and fibroblast (CV-1) cell lines (Fig. 1
). Furthermore, we were able to demonstrate the ability of endogenous Pitx1 from gonadotrope cell lines (
T31 and LßT2) to bind to the previously defined Pitx1 site (Fig. 3
). However, we were intrigued to observe a significant residual Pitx1 response following mutation or deletion of the 101 (5'Pitx1) cis-element (Fig. 2
). This response did not appear to be due to a cryptic site within the reporter vector, pXP2, as it persisted in a second reporter vector, pGL3. We therefore analyzed the LHß gene promoter sequence and identified three potential Pitx1 cis-elements (Fig. 4
). One of these sites, which we call the 3'Pitx1B cis-element, was determined to bind Pitx1 on EMSA (Figs. 5
and 6
). In transfection analysis, mutation of the 3'Pitx1B site significantly blunted Pitx1 responsiveness and, in conjunction with mutation of the 5'Pitx1 site, eliminated the Pitx1 response (Fig. 7A
). Our data also suggested a possible role of site A within the 3' region, based on 5' deletion studies, although EMSA results were less conclusive. Nevertheless, it is possible that both sequences in the 3' region act cooperatively to confer Pitx1 responses.
We also analyzed the functional interaction between SF-1 and Pitx1. Mutation of the 5'Pitx1 site markedly blunted synergistic effects by these transcription factors (Figs. 7B and C
). Mutation of the 3'Pitx1B site alone did not impact the degree to which Pitx1 was able to augment the SF-1 response although mutation of this site further decreased the residual Pitx1SF-1 synergy observed with an isolated 5'Pitx1 mutation. On EMSA, following the addition of Pitx1 and SF-1 to the 5'Pitx1SF-1 region, we were able to detect formation of a larger complex consistent with simultaneous binding by both of these factors (Fig. 9A
). In contrast, this larger complex was not detectable on the 3' region probe (Fig. 9C
). We propose that Pitx1 competes with SF-1 for binding to the 3' region, with the proportion of SF-1 to Pitx1 binding dependent on relative expression levels, relative affinity, or possibly activation by ligand in the case of SF-1. Pitx1 bound to the 3' region could potentially interact with SF-1 bound to the 5' SF-1 cis-element, but our data suggest that the 3'Pitx1 site plays a relatively small role in providing synergy with SF-1 (Figs. 7B and C
). Based on these functional and binding data, we conclude that Pitx1SF-1 synergy is dependent on Pitx1 DNA binding in the rat LHß gene.
It should be noted that we have been unable to definitively detect binding by endogenous Pitx1 from LßT2 nuclear extracts on the 3' region despite the use of a variety of nuclear extraction and EMSA protocols. While we were able to detect binding to the 5' site (Fig. 3
), these data required relatively large amounts of nuclear extract and prolonged exposure times. As the 3' region has lower affinity than the 5' site (Fig. 5
), we believe that our inability to detect endogenous Pitx1 binding to the 3' region is due to a lack of assay sensitivity, rather than a reflection of inability of Pitx1 to bind to this region. There is precedent for the presence of low affinity, but functionally important, Pitx1 cis-elements in other gonadotrope-specific genes, including the GnRH receptor gene as reported by Jeong and coworkers (2004).
In our studies of the rat LHß gene promoter, the 3'Pitx1 region contributed little to the synergistic response to Pitx1SF-1 (Fig. 7B
); however, functional interaction was lost with mutation of both putative Pitx1 regions. In contrast, mutation of the 3' region clearly blunted the Pitx1Egr-1 interaction, although neither site was absolutely required for synergy between these two factors (Fig. 10
). Mutation of the 5'Pitx1 cis-element alone blunted the response to either pair of transcription factors. Thus, our data clearly suggest that the 5' and 3' Pitx1 regions differ in terms of Pitx1 binding affinity as well as importance for interaction with other transcription factors.
Tremblay and colleagues have evaluated Pitx1 effects on the bovine LHß gene promoter (Tremblay et al. 1998, 1999). They reported that synergy between Pitx1 and SF-1 was maintained, although diminished, despite mutation in the 5'Pitx1 site. Of note, the bovine gene lacks an obvious Pitx1 consensus site in the 3' region identified in the rat promoter. As a result, this persistent response cannot be attributed to an analogous secondary Pitx1 site in this species. Tremblay et al. next demonstrated direct proteinprotein interaction between the C-terminus of Pitx1 and the N-terminus of SF-1 and postulated that physical interaction between these two proteins unmasks SF-1 activity by mimicking the effect of a still unidentified SF-1 ligand. They concluded that Pitx1SF-1 synergy can occur in the absence of Pitx1 DNA binding in the bovine promoter, a molecular mechanism which does not appear to exist for Pitx1SF-1 in the rat gene. Zakaria et al.(2002) have described a similar activating pathway that is independent of Pitx1 DNA binding in the rat FSHß gene.
Precedent exists for species-specific regulation of the LHß gene. For example, the bovine LHß gene 5' flanking region contains an NF-Y cis-element that is critical for mediating basal expression in this species, but is absent in the rat promoter. Conversely, the rat LHß promoter sequence contains an Sp1 region which is lacking in the corresponding bovine sequence (Keri et al. 2000).
The presence of multiple Pitx1 cis-elements appears to be a common theme. For example, the salmon LHß gene promoter contains two Pitx1 DNA-regulatory regions (neither clearly analogous to the mammalian regions): (1) a proximal cis-element which interacts with SF-1 and the estrogen receptor and confers a small degree of GnRH-responsiveness, and (2) a complex distal region with at least four Pitx1 sites which contribute to basal and GnRH-induced expression (Melamed et al. 2002). Of interest, Pitx1 is not required for GnRH expression in either the rat or bovine LHß genes (Quirk et al. 2001 and data not shown).
The importance of Pitx1 for gonadotrope development and gene expression has been underscored by the generation of both Pitx1 transgenic and Pitx1-null mouse models (Szeto et al. 1999, Quirk et al. 2001). In animals null for Pitx1 expression, analysis from embryonic day 15.5 through postpartum day 0 demonstrated markedly blunted expression of LHß, FSHß, TSHß and
-subunit due to both a decrease in the number of gonadotropes and thyrotropes as well as a decrease in transcript levels per cell. Quirk et al.(2001) generated mice harboring the bovine LHß gene promoter upstream of a chloramphenicol acetyltransferase (CAT) reporter. CAT activity was undetectable in all lines containing a mutation in the bovine LHß-5'Pitx1 site. These data do not formally eliminate the possibility of a second Pitx1 site; however, they clearly suggest that activation of additional DNA-regulatory elements is unable to compensate for loss of this site. As discussed above, Pitx1-mediated stimulation of LHß gene expression also may differ between species. Therefore, it would ultimately be of interest to generate transgenic mice containing rat LHß promoter sequences.
Elimination of Pitx1 protein expression in the knockout animals was less disruptive on pituitary function than mutation of the LHß 5'Pitx1 site (Szeto et al. 1999, Quirk et al. 2001). These results suggest that other transcription factors may be assuming the role of Pitx1 on this promoter. As one possibility, Rosenberg & Mellon (2002) have demonstrated the presence of an as-yet-unidentified Otx-related protein present in immortalized gonadotrope cells which binds to the 5'Pitx1 region and directs expression to mature gonadotropes. If identified, it would be important to test this factor for functional activity on the rat LHß 3'Pitx1 cis-element.
In conclusion, a wide array of in vivo and in vitro data point to a critical role for Pitx1 in pituitary development and gene expression. We have identified a second functional Pitx1 cis-element in the rat LHß gene promoter which contributes to Pitx1 responsiveness. These results further our understanding of the molecular mechanisms which regulate expression of this critical reproductive gene.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Dorn C, Ou Q, Svaren J, Crawford PA & Sadovsky Y 1999 Activation of luteinizing hormone beta gene by gonadotropin-releasing hormone requires the synergy of early growth response-1 and steroidogenic factor-1. Journal of Biological Chemistry 274 1387013876.
Drouin J, Lamolet B, Lamonerie T, Lanctot C & Tremblay JJ 1998 The PTX family of homeodomain transcription factors during pituitary developments. Molecular and Cellular Endocrinology 140 3136.[CrossRef][ISI][Medline]
Edlund T, Walker MD, Barr PJ & Rutter WJ 1985 Cell specific expression of the rat insulin gene: evidence for a role of two distinct 5' flanking elements. Science 230 912916.
Halvorson LM, Kaiser UB & Chin WW 1996 Stimulation of luteinizing hormone beta gene promoter activity by the orphan nuclear receptor, steroidogenic factor-1. Journal of Biological Chemistry 271 66456650.
Halvorson LM, Ito M, Jameson JL & Chin WW 1998 Steroidogenic factor-1 and early growth response protein 1 act through two composite DNA binding sites to regulate luteinizing hormone beta-subunit gene expression. Journal of Biological Chemistry 273 1471214720.
Jeong KH, Chin WW & Kaiser UB 2004 Essential role of the homeodomain for pituitary homeobox 1 activation of mouse gonadotropin-releasing hormone receptor gene expression through interactions with c-Jun and DNA. Molecular and Cellular Biology 24 61276139.
Kaiser UB, Sabbagh E, Chen MT, Chin WW & Saunders BD 1998 Sp1 binds to the rat luteinizing hormone beta (LHbeta) gene promoter and mediates gonadotropin-releasing hormone-stimulated expression of the LHbeta subunit gene. Journal of Biological Chemistry 273 1294312951.
Kaiser UB, Halvorson LM & Chen MT 2000 Sp1, steroidogenic factor 1 (SF-1), and early growth response protein 1 (egr-1) binding sites form a tripartite gonadotropin-releasing hormone response element in the rat luteinizing hormone-beta gene promoter: an integral role for SF-1. Molecular Endocrinology 14 12351245.
Keri RA & Nilson JH 1996 A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone beta subunit promoter in gonadotropes of transgenic mice. Journal of Biological Chemistry 271 1078210785.
Keri RA, Bachmann DJ, Behrooz A, Herr BD, Ameduri RK, Quirk CC & Nilson JH 2000 An NF-Y binding site is important for basal, but not gonadotropin-releasing hormone-stimulated, expression of the luteinizing hormone beta subunit gene. Journal of Biological Chemistry 275 1308213088.
Kurotani R, Tahara S, Sanno N, Teramoto A, Mellon PL, Inoue K, Yoshimura S & Osamura RY 1999 Expression of Pitx1 in the adult rat pituitary glands and pituitary cell lines: hormone-secreting cells and folliculo-stellate cells. Cell and Tissue Research 298 5561.[CrossRef][Medline]
Lala DS, Rice DA & Parker KL 1992 Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor I. Molecular Endocrinology 6 12491258.[Abstract]
Lamonerie T, Tremblay JJ, Lanctot C, Therrien M, Gauthier Y & Drouin J 1996 Pitx1, a bicoid-related homeo box transcription factor involved in transcription of the pro-opriomelanocortin gene. Genes and Development 10 12841295.
Lanctot C, Lamolet B & Drouin J 1997 The bicoid-related homeoprotein Pitx1 defines the most anterior domain of the embryo and differentiates posterior from anterior lateral mesoderm. Development 124 28072817.[Abstract]
Lanctot C, Gauthier Y & Drouin J 1999 Pituitary homeobox 1 (Pitx1) is differentially expressed during pituitary development. Endocrinology 140 14161422.
Melamed P, Koh M, Preklathan P, Bei L & Hew C 2002 Multiple mechanisms for Pitx-1 transactivation of a luteinizing hormone beta subunit gene. Journal of Biological Chemistry 277 2620026207.
Nordeen S 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6 454458.[ISI][Medline]
Parker KL, Ikeda Y & Luo X 1996 The roles of steroidogenic factor-1 in reproductive function. Steroids 61 161165.[CrossRef][ISI][Medline]
Quentien MH, Manfroid I, Moncet D, Gunz G, Muller M, Grino M, Enjalbert A & Pellegrini I 2002 Pitx factors are involved in basal and hormone-regulated activity of the human prolactin promoter. Journal of Biological Chemistry 277 4440844416.
Quirk CC, Lozada KL, Keri RA & Nilson JH 2001 A single Pitx1 binding site is essential for activity of the LHbeta promoter in transgenic mice. Molecular Endocrinology 15 734746.
Rosenberg SB & Mellon PL 2002 An Otx-related homeodomain protein binds an LHbeta promoter element important for activation during gonadotrope maturation. Molecular Endocrinology 16 12801298.
Sambrook J, Fritsch EF & Maniatis T 1989 Molecular Cloning: a Laboratory Manual. New York: Cold Spring Harbor Press.
Szeto DP, Rodriguez-Esteban C, Ryan AK, OConnell SM, Liu F, Kioussi C, Gleiberman AS, Izpisua-Belmonte JC & Rosenfeld MG 1999 Role of the Bicoid-related homeodomain factor Pitx1 in specifying hindlimb morphogenesis and pituitary development. Genes and Development 13 484494.
Thomas P, Mellon PL, Turgeon J & Waring DW 1996 The L beta T2 clonal gonadotrope: a model for single cell studies of endocrine cell secretion. Endocrinology 137 29792989.[Abstract]
Tremblay JJ & Drouin J 1999 Egr-1 is a downstream effector of GnRH and synergizes by direct interaction with Pitx1 and SF-1 to enhance luteinizing hormone beta gene transcription. Molecular and Cellular Biology 19 25672576.
Tremblay JJ, Lanctot C & Drouin J 1998 The pan-pituitary activator of transcription, Pitx1 (pituitary homeobox 1), acts in synergy with SF-1 and Pit1 and is an upstream regulator of the Lim-homeodomain gene Lim3/Lhx3. Molecular Endocrinology 12 428441.
Tremblay JJ, Marcil A, Gauthier Y & Drouin J 1999 Pitx1 regulates SF-1 activity by an interaction that mimics the role of the ligand-binding domain. EMBO Journal 18 34313441.[CrossRef][ISI][Medline]
Windle JJ, Weiner RI & Mellon PL 1990 Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice. Molecular Endocrinology 4 597603.[Abstract]
Wolfe MW 1999 The equine luteinizing hormone beta-subunit promoter contains two functional steroidogenic factor-1 response elements. Molecular Endocrinology 13 14971510.
Wolfe MW & Call GB 1999 Early growth response protein 1 binds to the luteinizing hormone-beta promoter and mediates gonadotropin-releasing hormone-stimulated gene expression. Molecular Endocrinology 13 752763.
Zakaria MM, Jeong KH, Lacza C & Kaiser UB 2002 Pituitary homeobox 1 activates the rat FSHbeta (rFSHbeta) gene through both direct and indirect interactions with the rFSHbeta gene promoter. Molecular Endocrinology 16 18401852.
Zhao L, Bakke M & Parker KL 2001 Pituitary-specific knockout of steroidogenic factor 1. Molecular and Cellular Endocrinology 185 2732.[CrossRef][ISI][Medline]
Received 13 May 2005
Accepted 18 May 2005
This article has been cited by other articles:
![]() |
A. Henke, C. Marc Luetjens, M. Simoni, and J. Gromoll Chorionic Gonadotropin {beta}-Subunit Gene Expression in the Marmoset Pituitary Is Controlled by Steroidogenic Factor 1, Early Growth Response Protein 1, and Pituitary Homeobox Factor 1 Endocrinology, December 1, 2007; 148(12): 6062 - 6072. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks Physiol Rev, July 1, 2007; 87(3): 933 - 963. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||