JME Society for Endocrinology Archive
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Molecular Endocrinology (2005) 35 145-158    DOI: 10.1677/jme.1.01754
© 2005 Society for Endocrinology

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, Q.
Right arrow Articles by Halvorson, L. M
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, Q.
Right arrow Articles by Halvorson, L. M

Pituitary homeobox 1 (Pitx1) stimulates rat LHß gene expression via two functional DNA-regulatory regions

Qiaorong Jiang, Kyeong-Hoon Jeong1, Cheryl D Horton2 and Lisa M Halvorson

Division of Reproductive Endocrinology, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, Dallas, TX 75390-9032, USA
1 Division of Endocrinology, Diabetes, and Hypertension, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115, USA
2 Department of Obstetrics and Gynecology, Tufts–New England Medical Center, Boston, MA 02111, USA

(Requests for offprints should be addressed to Lisa M Halvorson; Email: Lisa.Halvorson{at}UTSouthwestern.edu)


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Luteinizing hormone (LH) plays a central role in the reproductive axis, stimulating both gonadal steroid biosynthesis and the development of mature gametes. Over the past decade, significant progress has been made in characterizing the transcription factors and associated DNA-regulatory sites which mediate expression of the LH ß-subunit gene (LHß). One of these factors, pituitary homeobox 1 (Pitx1), has been shown to stimulate LHß gene promoter activity, both alone and in synergy with the orphan nuclear receptor, steroidogenic factor-1 (SF-1), and the early growth response gene 1 (Egr-1). Prior reports have attributed the Pitx1 response to a cis-element located at position -101 in the rat LHß gene promoter. While investigating the role of Pitx1 in regulating rat LHß gene expression, we observed a small, but significant, residual Pitx1 response despite mutation or deletion of this site. In the studies presented here, we identify the presence of a second functional Pitx1 region spanning positions –73 to –52 in the rat LHß gene promoter. Based on electrophoretic mobility shift assay, Pitx1 binds to both the initially described 5'Pitx1 site as well as this putative 3'Pitx1 region. In transient transfection analysis, mutation of the LHß-3'Pitx1 site significantly blunted Pitx1 responsiveness, with elimination of the Pitx1 response in a construct containing mutations in both Pitx1 cis-elements. We also analyzed the importance of each of these Pitx1 sites for providing functional synergy with SF-1 and with Egr-1. We observed a markedly decreased synergistic response with mutation of the 5'Pitx1 site with further loss following mutation of the 3'Pitx1 site. In contrast, functional interaction between Pitx1 and Egr-1 persisted with mutation of both Pitx1 regions. We conclude that Pitx1 stimulates the rat LHß gene promoter via two Pitx1 DNA-regulatory regions. These results further our understanding of the molecular mechanisms that regulate expression of this critical reproductive gene promoter.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The gonadotropins, luteinizing hormone (LH) and follicle-stimulating hormone (FSH), are critical modulators of sexual development and reproductive function, acting on the gonads to stimulate both steroidogenesis and gametogenesis. Produced by the gonadotrope subpopulation of the anterior pituitary gland, LH and FSH are heterodimeric glycoproteins composed of a common {alpha}-subunit linked non-covalently to one of two unique ß-subunits (LHß and FSHß, respectively). These ß-subunits provide the functional specificity that distinguishes LH from FSH via interactions with distinct G-protein-coupled receptors. Biosynthesis of the ß-subunits is believed to be the rate-limiting step in the generation of physiologically active heterodimers.

Over the past decade, substantial progress has been made in the identification of the transcription factors which are required for basal, tissue-specific, and gonadotropin-releasing hormone (GnRH)-activated expression of the LHß-subunit gene, including steroidogenic factor-1 (SF-1), early growth response gene 1 (Egr-1) and Sp1 (Halvorson et al. 1996, 1998, Keri & Nilson 1996, Parker et al. 1996, Wolfe 1999, Kaiser et al. 2000, Zhao et al. 2001). More recent investigations have demonstrated a critical role for the transcription factor pituitary homeobox 1 (Pitx1) in both anterior pituitary development as well as the regulation of a broad array of pituitary-specific genes in the adult (Lamonerie et al. 1996, Lanctot et al. 1997, Drouin et al. 1998, Tremblay et al. 1998, Kurotani et al. 1999, Lanctot et al. 1999, Quirk et al. 2001, Quentien et al. 2002, Zakaria et al. 2002, Jeong et al. 2004).

Pitx1, and the closely related proteins Pitx2 and Pitx3, are members of the bicoid-related homeodomain protein family. During embryonic development, Pitx1 and Pitx2 are expressed in the epithelia of the oral cavity and the first branchial arch, structures which subsequently develop into the anterior pituitary gland, nasopharynx, palate, tongue, and olfactory and dental epithelium. In later development, Pitx1 contributes to the differentiation of anterior pituitary lineages through synergism with cell-restricted transcription factors such as SF-1 (gonadotropes), Pit1 (lactotropes and somatotropes), and bHLH NeuroD1/Pan1 (corticotropes; Szeto et al. 1999, Tremblay & Drouin 1999, Tremblay et al. 1999).

Mice homozygous for deletion of the Pitx1 gene undergo normal early pituitary organogenesis, perhaps due to the compensatory effects of Pitx2; however, subsequent pituitary development is markedly abnormal. Both mRNA and protein levels of LHß, FSHß, and thyroid-stimulating hormone (TSH) ß are substantially reduced in Pitx1-null animals with a less-marked decrease in glycoprotein {alpha}-subunit levels (Szeto et al. 1999).

Pitx1 expression persists in the adult pituitary gland. Based on analysis of pituitary-derived cell lines, Pitx1 mRNA and protein are expressed in all pituitary lineages, with particularly high expression levels in cell lines which express the glycoprotein {alpha}-subunit (i.e. gonadotropes and thyrotropes) (Tremblay et al. 1998, Kurotani et al. 1999). Within gonadotropes, Pitx1 has been demonstrated to stimulate expression of the genes that encode the {alpha}-subunit, LHß, FSHß, and GnRH receptor (Tremblay et al. 1998, Quirk et al. 2001, Zakaria et al. 2002, Jeong et al. 2004). Pitx1-mediated transactivation of the LHß gene has been shown to be enhanced in the presence of the orphan nuclear hormone receptor, SF-1, as well as Egr-1 (Tremblay et al. 1998, 1999, Quirk et al. 2001).

We were interested in investigating the effect of Pitx1 and known transcriptional partners in regulation of the rat LHß gene promoter. In early experiments, we observed persistent Pitx1-stimulated promoter activity despite mutation of the previously described Pitx1 cis-element at position –101. In the studies reported here, we identify a second region in the proximal rat LHß gene promoter which binds Pitx1 and confers Pitx1 responsiveness. Furthermore, we characterize the importance of both of these sites for synergy between Pitx1 and SF-1 or Egr-1.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Plasmids used in transfection studies

The LHß reporter constructs used for these studies contain the 5'-flanking sequence of the rat LHß gene and the first 5 bp of the 5'-untranslated region fused to a luciferase reporter gene, pXP2 (Nordeen 1988). 5' deletions were created by subcloning PCR products containing the LHß promoter sequences into the pXP2 vector using BamHI/HindIII sites that were introduced by the primers (Kaiser et al. 1998). In a subset of experiments, the LHß promoter sequence was excised using BamHI and HindIII restriction enzymes and inserted into pGL3-Basic at BglI/HindIII (Promega, Madison, WI, USA). Mutations were introduced into the LHß promoter region using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA).

The mouse Pitx1 expression vector contains the Pitx1 open reading frame subcloned into pcDNA3/Amp (Invitrogen, Carlsbad, CA, USA; kindly provided by U B Kaiser, Brigham and Women’s Hospital, Boston, MA, USA; Jeong et al. 2004). The SF-1 expression vector contains 2.1 kb of the mouse SF-1 cDNA driven by the cytomegalovirus (CMV) promoter in the vector pCMV5 (provided by K L Parker, Southwestern University School of Medicine, Dallas, TX, USA; Lala et al. 1992).

Transient transfection of cell lines

Green monkey kidney fibroblasts (CV-1) and mouse gonadotrope-derived cells (LßT2 and AT3–1) were maintained in monolayer culture in low-glucose (CV-1) or high-glucose (LßT2) Dulbecco’s modified Eagle’s medium supplemented with 10% (v/v) certified fetal calf serum and 1% (v/v) penicillin/streptomycin at 37 °C in humidified 5% CO2/95% air. The immortalized gonadotrope cell lines were generously provided by Dr P L Mellon (University of California, San Diego, CA, USA; Windle et al. 1990, Thomas et al. 1996). Cells were transfected at 50–80% confluence in 12-well plates using the calcium phosphate precipitation method (CV-1 cells) or Lipofectamine reagent (LßT2 cells; Invitrogen; Sambrook et al. 1989). Cells received 0.4 µg/well of reporter vector and 0.1 µg/well of expression vector. Co-transfection with a Rous sarcoma virus (RSV)- ß-galactosidase plasmid allowed correction for differences in transfection efficiency between wells in all experiments. Cells were harvested approximately 48 h following transfection and the cell extracts analyzed for luciferase activity and ß-galactosidase activity using the Galacto-Light assay system (Applied Biosystems, Foster City, CA, USA; Edlund et al. 1985, deWet et al. 1987). Luciferase activity was normalized to the level of ß-galactosidase activity and results calculated as fold-change relative to expression in the control wells. Data are shown as the mean ± S.E.M. from 3–7 independent experiments.

Electrophoretic mobility shift assay (EMSA)

The nucleotide sequence of the rat LHß gene promoter is based on sequencing data available at GenBank accession number AF020505 [GenBank] . Double-stranded oligonucleotide probes were created by T4 polynucleotide kinase end-labeling with [{gamma}-32P]ATP followed by purification over a Quick Spin G-25 Sephadex column (Roche Applied Science, Indianapolis, IN, USA).

The following oligonucleotide sequences were utilized (substituted nucleotides underlined): (5'Pitx1) 5'-AGAG ATTAGTGTCTAGGTTACCCA-3'; (5'Pitx1 M) 5'-AGA ATTCAGTGTCTAGGTTACCCA-3'; (5'SF1-Pitx1) 5'-CTTTCTGACCTTGTCTGTCTCGCCCCCAAAGA GATTAGTGTCTA-3'; (5'SF1-Pitx1 M) 5'-CTTTCT GACCTTGTCTGTCTCGCCCCCAAAGAATTCAG TGTCTA-3'; (5'SF1 M-Pitx1) 5'-CTTTCTGAAATTGT CTGTCTCGCCCCCAAAGAGATTAGTGTCTA-3'; (5'SF1 M-Pitx1 M) 5'-CTTTCTGAAATTGTCTGTC TCGCCCCCAAAGAATTCAGTGTCTA-3'; (3'Pitx1) 5'-CCTGTAGCCTCTGCTTAGTGGCCTTGCCA C-3'; (3'Pitx1 MA) CCTGAATTCTCTGCTTAGTG GCCTTGCCAC; (3'Pitx1 MB) 5'-CTGTAGCCTCTG AATTCTGGCCTTGCCAC-3'; (3'Pitx1 MC) 5'-CCT GTAGCCTCTGCTTAGTGGAATTCCCAC-3'.

10 µg nuclear protein or 3 µg glutathione-S-transferase (GST) or GST–Pitx1 were incubated with 60 000 c.p.m. oligonucleotide probe in DNA-binding buffer (20 mM Hepes (pH 7.9), 60 mM KCl, 5 mM MgCl2, 10 mM PMSF, 10 mM dithiothreitol, 1 mg/ml BSA, and 5% (v/v) glycerol). Where indicated, an excess of unlabeled oligonucleotide or 2 µl of antisera was added 20 min prior to the addition of labeled probe. Protein–DNA complexes were resolved on a 5% nondenaturing polyacrylamide gel in 0.5xTris/borate/ EDTA buffer and subjected to autoradiography.

The GST–Pitx1 plasmid was generated by insertion of the Pitx1 cDNA downstream of the GST coding sequence in the pGEX-4T-2 expression vector (Amersham Biosciences Corp, Piscataway, NJ, USA) in the BamHI/NotI sites (construct provided by U B Kaiser; Jeong et al. 2004). This plasmid was introduced into a BL21 bacterial stock followed by induction with isopropyl ß-D-thiogalactosidase to induce expression of the fusion protein, which was purified on a GST-affinity column (Amersham Biosciences Corp).

Nuclear proteins were isolated using NE-PER Nuclear and Cytoplasmic Extraction Reagents and total protein concentration determined by bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL, USA). In vitro-translated SF-1 was generated from a plasmid containing 2.1 kb pairs of the mouse SF-1 cDNA (provided by Dr K L Parker) using the TNT Coupled Reticulocyte Lysate System (Promega).

The polyclonal Pitx1 antibody was generated in rabbits against a peptide corresponding to amino acids 24–52 of mouse Pitx1 conjugated to keyhole limpet hemocyanin (Covance Research, Richmond, CA, USA; provided by UB Kaiser; Zakaria et al. 2002).

To provide quantitation, autoradiographs were photographed using a Kodak digital camera (DC 290) and the net density of signals was evaluated by Kodak 1D Image Analysis software (Eastman Kodak Company, Rochester, NY, USA).

Statistical analysis

Statistical calculations was performed using the SigmaStat statistical software package (SPSS Science, Chicago, IL, USA). Data were analyzed for normality followed by calculation of analysis of variance (ANOVA) or the Kruskal–Wallis ANOVA on ranks for non-parametric data. The Student–Newman–Keuls method was utilized for post-hoc comparison, except for experiments with different sample sizes in which case Dunn’s test was employed. Statistical significance was set at P<0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
LHß gene expression is activated by Pitx1 and SF-1 acting alone and in synergy

We first analyzed the effect of Pitx1 and/or SF-1 on transactivation of the LHß gene promoter using transient transfection experiments in two cell lines, a gonadotrope-derived cell line (LßT2) and a fibroblast cell line (CV-1). Cells were transfected with a reporter construct containing region –207/+5 of the rat LHß gene promoter upstream of the luciferase reporter vector, pXP2. Cells were co-transfected with expression vectors for Pitx1 and/or SF-1. In CV-1 cells, which lack both transcription factors, LHß gene promoter activity was increased significantly with the addition of Pitx1 or SF-1 (17- and 55-fold, respectively; P<0.05 versus the empty control vector) (Fig. 1AGo). The addition of both factors produced a synergistic response of over 110-fold (P<0.05 versus control and versus Pitx1 or SF-1 alone). In LßT2 cells, overexpression of Pitx1 or SF-1 modestly, but significantly, increased LHß promoter activity relative to control wells (1.8- and 2-fold, respectively; P<0.05 versus control; Fig. 1BGo). Once again, a synergistic response was observed with the overexpression of both factors (7.5-fold; P<0.05 versus control and versus Pitx1 or SF-1 alone). The comparatively small magnitude of the response in the gonadotrope LßT2 cell line is likely due to the high level of endogenous Pitx1 expression reported in these cells. Therefore, in order to increase our ability to identify subtle changes in expression, we chose to continue our analysis in the CV-1 cell line.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1 Pitx1 and SF-1 act alone and in synergy to increase LHß gene promoter activity. Fibroblast CV-1 cells (A) and gonadotrope-derived LßT2 cells (B) were transiently transfected with region –207/+5 of the rat LHß gene promoter linked to a luciferase reporter construct, pXP2. Cells were co-transfected with CMV-driven expression vectors encoding Pitx1 and/or SF-1. Control wells received equivalent amounts of ‘empty’ expression vector. All cells were co-transfected with an RSV-ß-galactosidase vector to control for potential differences in transfection efficiency. Approximately 48 h after transfection, cells were analyzed for luciferase and ß-galactosidase activity. Luciferase activity was normalized to ß-galactosidase activity and promoter activity was calculated as fold-change over expression in the control wells. *P<0.05 versus control, #P<0.05 versus Pitx1 alone, +P<0.05 versus SF-1 alone.

 
Residual Pitx1 response with mutation or deletion of the previously identified Pitx1 element

We next evaluated the response to Pitx1 following deletion or mutation of the previously identified Pitx1 site (Fig. 2AGo). A statistically significant residual Pitx1 response was observed in the mutated construct (7.6-fold) and in the 5' deleted constructs (3.6- and 2-fold for the –82/+5 and –68/+5 constructs, respectively; P<0.05 versus response in the empty reporter vector, pXP2). In order to confirm this observation, additional constructs were generated which contained rat LHß gene sequences in a second luciferase reporter vector, pGL3. As shown in Fig. 2BGo, a residual Pitx1 response was again observed in a construct containing a mutation in the –101 Pitx1 site (2.8-fold; P<0.05 versus control). Taken together, these results suggested strongly the presence of a second functional Pitx1 cis-element in the LHß gene promoter.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 2 Identification of a residual Pitx1 response following mutation or deletion of the –101 Pitx1 cis-element. CV-1 cells were transfected with the indicated luciferase reporter construct and a Pitx1 expression vector or empty expression vector. Cells were harvested and results calculated as described in Fig. 1Go. (A) CV-1 cells were transfected with luciferase constructs containing region –207/+5 of the rat LHß gene promoter present as the wild-type or with mutation in the previously identified Pitx1 cis-element at position –101. Alternative wells were transfected with 5' deleted LHß promoter constructs or with the empty reporter vector, pXP2. *P<0.05 versus Pitx1 response in pXP2. (B) CV-1 cells were transfected with reporter constructs containing region –207/+5 of the wild-type or Pitx1-mutated rat LHß gene promoter linked to the luciferase reporter vector, pGL3. *P<0.05 versus Pitx1 response in pGL3.

 
Pitx1 present in gonadotropes binds to the LHß gene promoter

EMSA was used to characterize the site(s) at which Pitx1 interacts with the rat LHß gene promoter. As shown in Fig. 3AGo, nuclear extracts from the gonadotrope-derived {alpha}T3–1 cell line bound to an oligonucleotide probe which spans the –101 Pitx1 cis-element to produce a dominant band (Fig. 3AGo, lane 1). Formation of this complex was effectively competed by the addition of excess cold wild-type oligonucleotide (Fig. 3AGo, lane 2), but not by a mutated oligonucleotide (Fig. 3AGo, lane 3) or by an unrelated oligonucleotide containing the LHß 3'Egr-1 site (Fig. 3AGo, lane 4). Gonadotrope nuclear extract interacted weakly with the mutated oligonucleotide when used as a probe, demonstrating specificity of the protein–DNA interaction (Fig. 3AGo, lane 5).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 3 Endogenous Pitx1 in gonadotrope cell lines binds to the LHß gene promoter. Nuclear extracts from {alpha}T3–1 or LßT2 gonadotrope cells were incubated with 32P-labeled oligonucleotide probes and the reaction mixture run on a 5% non-denaturing polyacrylamide gel, dried, and subjected to autoradiography. (A) {alpha}T3–1 nuclear extract was added to a 32P-labeled oligonucleotide probe spanning region –103/–80 of the rat LHß gene promoter as the wild-type sequence (lanes 1–4) or with a mutation in the –101 Pitx1 (5'Pitx1) site (lane 5). Where indicated, a 500-fold excess of wild-type, 5'Pitx1-mutated, or unrelated unlabeled oligonucleotide was added to the reaction mixture (lanes 2, 3, and 4 respectively). (B) {alpha}T3–1 (lanes 1–3) or LßT2 nuclear extract (lanes 5 and 6) were added to the wild-type 5'Pitx1 probe. As indicated, a Pitx1-specific antibody or a pre-immune antibody (P.I.) was added 20 min prior to the addition of probe. In lane 4, Pitx1 antibody was added to probe without extract.

 
The identity of the dominant band was confirmed by the addition of a Pitx1-specific antiserum which blunted the Pitx1-containing complex (Fig. 3BGo, lanes 1 and 2). In contrast, a pre-immune antibody had no effect on this complex (Fig. 3BGo, lane 3). Nuclear extract from the differentiated LßT2 cell line was also demonstrated to contain endogenous Pitx1 which bound to the LHß 5'Pitx1 region (Fig. 3BGo, lanes 5 and 6).

Pitx1 binds to a second proximal site in the rat LHß gene promoter

Analysis of the proximal rat LHß gene promoter sequence identified three regions with homology to the consensus Pitx1 cis-element (TAA(T/G)CC). These putative cis-elements within the 3'Pitx1 region were designated sites A, B and C (Fig. 4Go). As shown in Fig. 5AGo, a GST–Pitx1 fusion protein bound with high affinity to the previously identified 5'Pitx1 site on EMSA (Fig. 5AGo, left-hand panel). This complex was effectively super-shifted by a Pitx1-specific antibody. Pitx1 also bound specifically to an oligonucleotide probe which spans all three putative 3' Pitx1 sites in the 3'Pitx1 region (Fig. 5AGo, right-hand panel).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 4 Schematic of the proximal rat LHß gene promoter sequence indicating DNA-regulatory elements for SF-1, Egr-1, and Pitx1. By sequence analysis, region –77 to –48 contains three sites with homology to the consensus Pitx1 cis-element. These putative cis-elements are named 3'Pitx1 sites A, B, and C. Note that the putative 3'Pitx1C overlaps the 3'SF-1-binding site (TGGCCTTGC).

 


View larger version (36K):
[in this window]
[in a new window]
 
Figure 5 Pitx1 binds to the 3'Pitx1 region in the LHß gene promoter. (A) GST–Pitx1 fusion protein was added to 32P-labeled oligonucleotide probes spanning the 5'Pitx1 or 3'Pitx1 regions. A Pitx1-specific antibody was added as described in Fig. 3Go (lanes 3 and 6). (B) The 3'Pitx1 probe was mixed with GST–Pitx1 and increasing amounts of 3'Pitx1 or 5'Pitx1 oligonucleotide. The intensity of the resulting complexes was quantified with the mean ± S.E.M. from three experiments shown.

 
Comparison of Pitx1 affinity for the 5'Pitx1 and 3'Pitx1 regions

Pitx1 was noted to produce a less-intense complex with the 3'Pitx1 probe than with the probe spanning the more distal Pitx1 cis-element. In order to estimate the relative efficiency of the Pitx1–DNA interaction in these two regions, a competitive EMSA experiment was performed (Fig. 5BGo). Pitx1 fusion protein was added to the oligonucleotide probe containing the 3'Pitx1 region. Increasing amounts of unlabeled 5' or 3'Pitx1 oligonucleotide were added and the intensity of the generated complex quantified. Based on results from three independent experiments, the Pitx1 binds the 5'Pitx1 site with approximately 6-fold greater affinity than the 3'Pitx1 region. This result is consistent with the relative functional importance of these two sites as assessed in transfection experiments.

Pitx1 binds with greatest intensity to site B within the putative 3'Pitx1 region of the proximal LH' gene

We next evaluated the ability of Pitx1 to bind to each of the putative 3'Pitx1 DNA-binding sites identified in the rat LHß gene promoter. Oligonucleotide probes were generated which contained mutations in each of these Pitx1 sites individually. As shown in Fig. 6AGo, mutation of site B essentially eliminated the ability of Pitx1 to bind to the probe. In contrast, substantial amounts of protein binding persisted following mutation of the A or C sites. The numerical data presented are based on the cumulative results from four assays, with binding to the wild-type probe set at 100%. Of interest, binding to site A was somewhat decreased in the experiment shown in this figure, raising the possibility that it may contribute to Pitx1 effects.



View larger version (46K):
[in this window]
[in a new window]
 
Figure 6 Pitx1 binds to site B within the 3'Pitx1 region. (A) GST–Pitx1 protein was added to 32P-labeled oligonucleotide probes spanning the 3'Pitx1 regions as the wild-type sequence or with mutation in putative sites A, B, or C. The intensity of the resulting complexes was quantified and results expressed as a percentage of binding to the wild-type probe (n=4). (B) GST–Pitx1 protein was added to the 3'Pitx1 probe. 500-fold excess of wild-type or mutated 3'Pitx1 oligonucleotide was added as indicated. Results from three independent experiments were quantified and results expressed as the percentage intensity of the control band (i.e. no competitor).

 
The mutated oligonucleotides were also tested in competition experiments. Due to the relative subtlety of these differences by visual analysis, this experiment was repeated three times and the intensity of the complexes formed quantified. These data were pooled and expressed as a percentage of the ‘no competition’ control band. As shown in Fig. 6BGo, excess oligonucleotide containing either the wild-type sequence or a mutation in site A or site C decreased complex formation between Pitx1 protein and the wild-type 3'Pitx1 probe by approximately 30–50%. In contrast, the site B mutant oligonucleotide was unable to compete for Pitx1 binding. Taken together, these EMSA data demonstrate the ability of Pitx1 to bind to site B located at position – 66/–60 in the rat LHß gene promoter.

The 3'Pitx1 region contributes to Pitx1-induced activation of the rat LHß gene

In order to test the functional importance of site B, additional luciferase reporter constructs were generated which contained mutations in this site, either alone or in conjunction with the mutated 5'Pitx1 cis-element. As shown in Fig. 7AGo, mutation of site B in the 3'Pitx1 region significantly blunted the Pitx1 response in the rat LHß gene promoter, with complete loss of Pitx1-responsiveness in the presence of the double mutation.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 7 Effect of mutation of the Pitx1 sites on the Pitx1 response and Pitx1–SF-1 synergy. CV-1 cells were transiently transfected with the –207/+5LHß gene promoter present as wild-type or with mutation in the 5'Pitx1 cis-element, 3'Pitx1B cis-element, or both. Cells were co-transfected with the Pitx1 and/or SF-1 expression vectors. Cell extracts were harvested and assayed as described in Fig. 1Go. (A) Analysis of the Pitx1 response. Results shown as promoter activity in response to the Pitx1 expression vector relative to promoter activity with addition of the control expression vector. *P<0.05 versus the response in pXP2. (B) Analysis of Pitx1–SF-1 synergy. Results shown as corrected luciferase activity in response to the Pitx1 and SF-1 expression vectors relative to luciferase activity with addition of the control expression vector. *P<0.05 versus the response in pXP2. (C) LHß gene promoter activity in response to Pitx1 and SF-1 together relative to addition of SF-1 alone. *P<0.05 for the response to SF-1+Pitx1 versus response to SF-1 alone.

 
Functional analysis of the role of site A was determined by 5' truncation as already shown in Fig. 2AGo, with deletion of this site occurring with 5' truncation from position –82 to –68. The Pitx1 response decreased from 3.6-fold in the presence of the complete 3' region to 2.0-fold in the shorter construct (P<0.05 for construct –82/+5 versus –68/+5), suggesting that site A may contribute to the Pitx1 response in the presence of an intact site B.

We also were interested in investigating the role of each of the Pitx1 cis-elements in mediating the synergistic response with SF-1 (Fig. 7BGo). The addition of both Pitx1 and SF-1 increased luciferase activity by over 100-fold in the wild-type rat LHß gene promoter. In the 5'Pitx1-mutated construct, transfection of Pitx1 and SF-1 produced a response that was greater than additive for the two factors alone (5-, 17-, and 43-fold for Pitx1, SF-1, and Pitx1+SF-1, respectively), but was diminished relative to the wild-type promoter. Mutation of the 3'Pitx1 cis-element had minimal impact on the synergistic response.

As an alternative method for analyzing the degree of synergy in the various constructs, the results were also calculated as the response to both transcription factors relative to the response to SF-1 alone. As shown in Fig. 7CGo, Pitx1–SF-1 synergy was decreased markedly with mutation of the 5'Pitx1 site in this series of experiments. Pitx1 augmentation of the SF-1 response was unchanged with mutation of the 3'Pitx1 site alone; however, synergy was eliminated with mutation of both Pitx1 cis-elements suggesting that the 3'Pitx1 site may play a minor role in the interaction between SF-1 and Pitx1.

The importance of the 3'Pitx1 site was also evaluated in the gonadotrope LßT2 cell line. As shown in Fig. 8Go (upper panel), mutation of the putative 3'Pitx1 site blunted LHß-driven luciferase activity in LßT2 cells, although not to the extent observed with mutation of the 5' site (P<0.005 versus wild-type for all mutant constructs). This result is consistent with an inability of endogenous Pitx1 to transactivate the mutated sequences. Quirk and colleagues (2001) similarly have shown that mutation of the 5'Pitx1 element blocks activation of the bovine LHß promoter in LßT2 cells. Our interpretation of these data is further supported by equivalent analysis in Pitx1-deficient CV-1 cells in which mutation of the Pitx1 sites did not blunt basal expression (Fig. 8Go, lower panel).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 8 Mutation of the Pitx1 sites blunts rat LHß promoter expression in the gonadotrope LßT2 cell line. LßT2 cells (upper panel) or CV-1 cells (lower panel) were transiently transfected with region –207/+5 of the rat LHß gene promoter linked to a luciferase reporter construct, pXP2, present as the wild-type or with mutations in the putative 5' or 3'Pitx1 sites or both. Cells were analyzed for reporter activity approximately 48 h after transfection. The data shown represent three independent experiments with expression in the wild-type construct set at 100%. *P<0.005 versus wild-type for all mutant constructs.

 
Evidence that Pitx1 and SF-1 bind simultaneously to the 5'Pitx1 region but not to the 3'Pitx1 region

Our transfection data demonstrated that the 5'Pitx1 site is more important than the 3'Pitx1 site in conferring transcriptional synergy by Pitx1 and SF-1. We investigated whether this differential response could be explained by differences in the ability of SF-1 and Pitx1 to bind simultaneously to adjacent Pitx1 and SF-1 cis-elements.

As shown on the left-hand side of Fig. 9AGo, SF-1 and Pitx1 bound independently to a probe spanning the 5'SF-1 and 5'Pitx1 cis-elements (Fig. 9AGo, lanes 2 and 4, respectively). A third, larger complex was generated with the addition of both proteins together (Fig. 9AGo, lane 5), suggesting concurrent binding of SF-1 and Pitx1 to this DNA region. This result cannot distinguish direct DNA binding by both factors from DNA binding by a single factor that has formed a complex with a non-DNA binding partner. To further investigate this issue, oligonucleotide probes were utilized which contained mutations in the Pitx1 region (Fig. 9AGo, lanes 6–10), or in the SF-1 site (Fig. 9BGo, lanes 1–5), or in both sites (Fig. 9BGo, lanes 6–10). Mutation of the 5'Pitx1 region maintained SF-1 binding (Fig. 9AGo, lane 7) but nearly eliminated Pitx1 binding (Fig. 9AGo, lane 9), whereas mutation of the 5'SF-1 site had the converse effect (Fig. 9BGo, lanes 2 and 4). No evidence of a higher-order complex was observed with either of the mutated probes, arguing against the ability of either SF-1 or Pitx1 to bind indirectly to the 5' region.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 9 SF-1 and Pitx1 bind simultaneously to the 5'SF1-Pitx1 region but not to the 3'SF1-Pitx1 region. EMSA was utilized to evaluate the ability of Pitx1 and SF-1 to bind to the 5' and 3' SF1–Pitx1 regions. (A) Pitx1 fusion protein and in vitro-translated SF-1 were added alone (lanes 2 and 4) or in combination (lane 5) to an oligonucleotide probe spanning the 5'Pitx1 and 5'SF-1 sites (left panel). * Indicates complex containing both SF-1 and Pitx1. Mutation of the Pitx1 site prevented binding by Pitx1 either alone (lane 9) or in the presence of SF-1 (lane 10). (B) SF-1 (lanes 2 and 7) and Pitx1 (lanes 4 and 9) were added to a probe containing a mutation in the 5'SF-1 site (left) or in both the 5'SF-1 and 5'Pitx1 sites (right). SF-1 and Pitx1 were added in combination in lanes 5 and 10. (C) SF-1 (lane 2) and Pitx1 (lane 4) bind to a probe spanning the 3'SF-1 and 3'Pitx1 sites. No additional complexes were noted in the presence of both proteins (lane 5). RL, reticulocyte lysate.

 
In Fig. 9CGo, we investigated the ability of Pitx1 and SF-1 to bind to an oligonucleotide probe spanning the 3'SF-1 and Pitx1 sites (probe 3'Pitx1). In contrast to the results obtained with the 5' region, we did not observe cooperative binding to the 3' region (Fig. 9CGo, lane 5). In conjunction with the transfection data, these results are consistent with a model in which DNA binding at adjacent Pitx1 and SF-1 sites, as occurs in the 5' region of the LHß gene, is important for functional synergy between these two transcription factors.

Both Pitx1 regions contribute to synergy with Egr-1 on LHß gene expression

Previous reports have demonstrated functional synergy between Pitx1 and Egr-1, an immediate early gene which is highly induced by GnRH. Our group and others have characterized two Egr-1 cis-elements in the LHß gene promoter located near the SF-1 and Pitx1 sites (Halvorson et al. 1998, 1999, Dorn et al. 1999, Tremblay & Drouin 1999, Wolfe & Call 1999). We investigated the importance of the two Pitx1 DNA-regulatory regions in conferring functional synergy using transfection experiments that paralleled those shown for Pitx1 and SF-1 in Fig. 7Go. As demonstrated previously, Pitx1 and Egr-1 interact cooperatively to stimulate LHß gene promoter activity (Fig. 10AGo). Next, the response to Pitx1 and Egr-1 together was evaluated in the wild-type and Pitx1 mutation constructs (Fig. 10BGo). Mutation of the 5' and/or 3' Pitx1 regions significantly decreased the Pitx1–Egr-1 response relative to the wild-type promoter sequence (P<0.05), consistent with a contribution by both regions to this response. Interestingly, the response to both transcription factors exceeded the response to either transcription factor alone in the double mutant construct (Fig. 10B and CGo). This result suggests that Pitx1–Egr-1 synergy does not require binding by Pitx1, unlike the result observed for the Pitx1–SF-1 interaction.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 10 Effect of mutation of the Pitx1 sites on Pitx1–Egr-1 synergy. CV-1 cells were transiently transfected with the –207/+5LHß gene promoter present as wild-type or with mutation in the 5'Pitx1 cis-element, 3'Pitx1B cis-element, or both. Cells were co-transfected with the Pitx1 and/or Egr-1 expression vectors, as indicated. (A) Response of the wild-type rat LHß gene promoter to Pitx1, Egr-1, or both transcription factors. Promoter activity calculated as fold-change over expression in the control wells which received ‘empty’ expression vector. *P<0.001 versus control, #P<0.01 versus Pitx1 alone, +P<0.001 versus Egr-1 alone. (B) Analysis of Pitx1–Egr-1 synergy. Results shown as corrected luciferase activity in the presence of both the Pitx1 and Egr-1 expression vectors relative to luciferase activity with addition of the control expression vector. *P<0.005 versus response in pXP2. (C) LHß gene promoter activity in response to Pitx1 and Egr-1 together relative to addition of Egr-1 alone. *P<0.005 for the response to Pitx1+Egr-1 versus response to Egr-1 alone.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Regulation of gonadotropin biosynthesis and secretion is a critical step in the maintenance of normal reproductive function in both males and females. Investigations from a number of laboratories have begun to elucidate the complex interactions which mediate expression of the LHß gene. In vivo and in vitro experiments have established a role for the homeobox gene product, Pitx1, in mediating LHß promoter activity, both alone and in synergy with the transcription factors SF-1 and Egr-1 (Tremblay et al. 1998, Tremblay & Drouin 1999, Quirk et al. 2001). While previously believed to occur through a single Pitx1 DNA-regulatory site located at position –101 in the rat LHß gene promoter, we now present data that identify the presence of a second functional Pitx1 cis-element in this gene.

Our data confirmed the ability of SF-1 and Pitx1 to act independently and in synergy to stimulate LHß transcription in both gonadotrope (LßT2) and fibroblast (CV-1) cell lines (Fig. 1Go). Furthermore, we were able to demonstrate the ability of endogenous Pitx1 from gonadotrope cell lines ({alpha}T3–1 and LßT2) to bind to the previously defined Pitx1 site (Fig. 3Go). However, we were intrigued to observe a significant residual Pitx1 response following mutation or deletion of the –101 (5'Pitx1) cis-element (Fig. 2Go). This response did not appear to be due to a cryptic site within the reporter vector, pXP2, as it persisted in a second reporter vector, pGL3. We therefore analyzed the LHß gene promoter sequence and identified three potential Pitx1 cis-elements (Fig. 4Go). One of these sites, which we call the 3'Pitx1B cis-element, was determined to bind Pitx1 on EMSA (Figs. 5Go and 6Go). In transfection analysis, mutation of the 3'Pitx1B site significantly blunted Pitx1 responsiveness and, in conjunction with mutation of the 5'Pitx1 site, eliminated the Pitx1 response (Fig. 7AGo). Our data also suggested a possible role of site A within the 3' region, based on 5' deletion studies, although EMSA results were less conclusive. Nevertheless, it is possible that both sequences in the 3' region act cooperatively to confer Pitx1 responses.

We also analyzed the functional interaction between SF-1 and Pitx1. Mutation of the 5'Pitx1 site markedly blunted synergistic effects by these transcription factors (Figs. 7B and CGo). Mutation of the 3'Pitx1B site alone did not impact the degree to which Pitx1 was able to augment the SF-1 response although mutation of this site further decreased the residual Pitx1–SF-1 synergy observed with an isolated 5'Pitx1 mutation. On EMSA, following the addition of Pitx1 and SF-1 to the 5'Pitx1–SF-1 region, we were able to detect formation of a larger complex consistent with simultaneous binding by both of these factors (Fig. 9AGo). In contrast, this larger complex was not detectable on the 3' region probe (Fig. 9CGo). We propose that Pitx1 competes with SF-1 for binding to the 3' region, with the proportion of SF-1 to Pitx1 binding dependent on relative expression levels, relative affinity, or possibly activation by ligand in the case of SF-1. Pitx1 bound to the 3' region could potentially interact with SF-1 bound to the 5' SF-1 cis-element, but our data suggest that the 3'Pitx1 site plays a relatively small role in providing synergy with SF-1 (Figs. 7B and CGo). Based on these functional and binding data, we conclude that Pitx1–SF-1 synergy is dependent on Pitx1 DNA binding in the rat LHß gene.

It should be noted that we have been unable to definitively detect binding by endogenous Pitx1 from LßT2 nuclear extracts on the 3' region despite the use of a variety of nuclear extraction and EMSA protocols. While we were able to detect binding to the 5' site (Fig. 3Go), these data required relatively large amounts of nuclear extract and prolonged exposure times. As the 3' region has lower affinity than the 5' site (Fig. 5Go), we believe that our inability to detect endogenous Pitx1 binding to the 3' region is due to a lack of assay sensitivity, rather than a reflection of inability of Pitx1 to bind to this region. There is precedent for the presence of low affinity, but functionally important, Pitx1 cis-elements in other gonadotrope-specific genes, including the GnRH receptor gene as reported by Jeong and coworkers (2004).

In our studies of the rat LHß gene promoter, the 3'Pitx1 region contributed little to the synergistic response to Pitx1–SF-1 (Fig. 7BGo); however, functional interaction was lost with mutation of both putative Pitx1 regions. In contrast, mutation of the 3' region clearly blunted the Pitx1–Egr-1 interaction, although neither site was absolutely required for synergy between these two factors (Fig. 10Go). Mutation of the 5'Pitx1 cis-element alone blunted the response to either pair of transcription factors. Thus, our data clearly suggest that the 5' and 3' Pitx1 regions differ in terms of Pitx1 binding affinity as well as importance for interaction with other transcription factors.

Tremblay and colleagues have evaluated Pitx1 effects on the bovine LHß gene promoter (Tremblay et al. 1998, 1999). They reported that synergy between Pitx1 and SF-1 was maintained, although diminished, despite mutation in the 5'Pitx1 site. Of note, the bovine gene lacks an obvious Pitx1 consensus site in the 3' region identified in the rat promoter. As a result, this persistent response cannot be attributed to an analogous secondary Pitx1 site in this species. Tremblay et al. next demonstrated direct protein–protein interaction between the C-terminus of Pitx1 and the N-terminus of SF-1 and postulated that physical interaction between these two proteins unmasks SF-1 activity by mimicking the effect of a still unidentified SF-1 ligand. They concluded that Pitx1–SF-1 synergy can occur in the absence of Pitx1 DNA binding in the bovine promoter, a molecular mechanism which does not appear to exist for Pitx1–SF-1 in the rat gene. Zakaria et al.(2002) have described a similar activating pathway that is independent of Pitx1 DNA binding in the rat FSHß gene.

Precedent exists for species-specific regulation of the LHß gene. For example, the bovine LHß gene 5' flanking region contains an NF-Y cis-element that is critical for mediating basal expression in this species, but is absent in the rat promoter. Conversely, the rat LHß promoter sequence contains an Sp1 region which is lacking in the corresponding bovine sequence (Keri et al. 2000).

The presence of multiple Pitx1 cis-elements appears to be a common theme. For example, the salmon LHß gene promoter contains two Pitx1 DNA-regulatory regions (neither clearly analogous to the mammalian regions): (1) a proximal cis-element which interacts with SF-1 and the estrogen receptor and confers a small degree of GnRH-responsiveness, and (2) a complex distal region with at least four Pitx1 sites which contribute to basal and GnRH-induced expression (Melamed et al. 2002). Of interest, Pitx1 is not required for GnRH expression in either the rat or bovine LHß genes (Quirk et al. 2001 and data not shown).

The importance of Pitx1 for gonadotrope development and gene expression has been underscored by the generation of both Pitx1 transgenic and Pitx1-null mouse models (Szeto et al. 1999, Quirk et al. 2001). In animals null for Pitx1 expression, analysis from embryonic day 15.5 through postpartum day 0 demonstrated markedly blunted expression of LHß, FSHß, TSHß and {alpha}-subunit due to both a decrease in the number of gonadotropes and thyrotropes as well as a decrease in transcript levels per cell. Quirk et al.(2001) generated mice harboring the bovine LHß gene promoter upstream of a chloramphenicol acetyltransferase (CAT) reporter. CAT activity was undetectable in all lines containing a mutation in the bovine LHß-5'Pitx1 site. These data do not formally eliminate the possibility of a second Pitx1 site; however, they clearly suggest that activation of additional DNA-regulatory elements is unable to compensate for loss of this site. As discussed above, Pitx1-mediated stimulation of LHß gene expression also may differ between species. Therefore, it would ultimately be of interest to generate transgenic mice containing rat LHß promoter sequences.

Elimination of Pitx1 protein expression in the knockout animals was less disruptive on pituitary function than mutation of the LHß 5'Pitx1 site (Szeto et al. 1999, Quirk et al. 2001). These results suggest that other transcription factors may be assuming the role of Pitx1 on this promoter. As one possibility, Rosenberg & Mellon (2002) have demonstrated the presence of an as-yet-unidentified Otx-related protein present in immortalized gonadotrope cells which binds to the 5'Pitx1 region and directs expression to mature gonadotropes. If identified, it would be important to test this factor for functional activity on the rat LHß 3'Pitx1 cis-element.

In conclusion, a wide array of in vivo and in vitro data point to a critical role for Pitx1 in pituitary development and gene expression. We have identified a second functional Pitx1 cis-element in the rat LHß gene promoter which contributes to Pitx1 responsiveness. These results further our understanding of the molecular mechanisms which regulate expression of this critical reproductive gene.


    Acknowledgements
 
We thank Ursula Kaiser for her generosity in providing the Pitx1 reagents used in these studies. This work was supported by R01 HD38089 (C D H, Q J, and L M H) and a Lalor Foundation Research Fellowship Grant (K-H J). The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
deWet JR, Wood KV, DeLuca M, Helinski DR & Subramani S 1987 Firefly luciferase gene: structure and expression in mammalian cells. Molecular and Cellular Biology 7 725–737.[Abstract/Free Full Text]

Dorn C, Ou Q, Svaren J, Crawford PA & Sadovsky Y 1999 Activation of luteinizing hormone beta gene by gonadotropin-releasing hormone requires the synergy of early growth response-1 and steroidogenic factor-1. Journal of Biological Chemistry 274 13870–13876.[Abstract/Free Full Text]

Drouin J, Lamolet B, Lamonerie T, Lanctot C & Tremblay JJ 1998 The PTX family of homeodomain transcription factors during pituitary developments. Molecular and Cellular Endocrinology 140 31–36.[CrossRef][Web of Science][Medline]

Edlund T, Walker MD, Barr PJ & Rutter WJ 1985 Cell specific expression of the rat insulin gene: evidence for a role of two distinct 5' flanking elements. Science 230 912–916.[Abstract/Free Full Text]

Halvorson LM, Kaiser UB & Chin WW 1996 Stimulation of luteinizing hormone beta gene promoter activity by the orphan nuclear receptor, steroidogenic factor-1. Journal of Biological Chemistry 271 6645–6650.[Abstract/Free Full Text]

Halvorson LM, Ito M, Jameson JL & Chin WW 1998 Steroidogenic factor-1 and early growth response protein 1 act through two composite DNA binding sites to regulate luteinizing hormone beta-subunit gene expression. Journal of Biological Chemistry 273 14712–14720.[Abstract/Free Full Text]

Jeong KH, Chin WW & Kaiser UB 2004 Essential role of the homeodomain for pituitary homeobox 1 activation of mouse gonadotropin-releasing hormone receptor gene expression through interactions with c-Jun and DNA. Molecular and Cellular Biology 24 6127–6139.[Abstract/Free Full Text]

Kaiser UB, Sabbagh E, Chen MT, Chin WW & Saunders BD 1998 Sp1 binds to the rat luteinizing hormone beta (LHbeta) gene promoter and mediates gonadotropin-releasing hormone-stimulated expression of the LHbeta subunit gene. Journal of Biological Chemistry 273 12943–12951.[Abstract/Free Full Text]

Kaiser UB, Halvorson LM & Chen MT 2000 Sp1, steroidogenic factor 1 (SF-1), and early growth response protein 1 (egr-1) binding sites form a tripartite gonadotropin-releasing hormone response element in the rat luteinizing hormone-beta gene promoter: an integral role for SF-1. Molecular Endocrinology 14 1235–1245.[Abstract/Free Full Text]

Keri RA & Nilson JH 1996 A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone beta subunit promoter in gonadotropes of transgenic mice. Journal of Biological Chemistry 271 10782–10785.[Abstract/Free Full Text]

Keri RA, Bachmann DJ, Behrooz A, Herr BD, Ameduri RK, Quirk CC & Nilson JH 2000 An NF-Y binding site is important for basal, but not gonadotropin-releasing hormone-stimulated, expression of the luteinizing hormone beta subunit gene. Journal of Biological Chemistry 275 13082–13088.[Abstract/Free Full Text]

Kurotani R, Tahara S, Sanno N, Teramoto A, Mellon PL, Inoue K, Yoshimura S & Osamura RY 1999 Expression of Pitx1 in the adult rat pituitary glands and pituitary cell lines: hormone-secreting cells and folliculo-stellate cells. Cell and Tissue Research 298 55–61.[CrossRef][Web of Science][Medline]

Lala DS, Rice DA & Parker KL 1992 Steroidogenic factor I, a key regulator of steroidogenic enzyme expression, is the mouse homolog of fushi tarazu-factor I. Molecular Endocrinology 6 1249–1258.[Abstract/Free Full Text]

Lamonerie T, Tremblay JJ, Lanctot C, Therrien M, Gauthier Y & Drouin J 1996 Pitx1, a bicoid-related homeo box transcription factor involved in transcription of the pro-opriomelanocortin gene. Genes and Development 10 1284–1295.[Abstract/Free Full Text]

Lanctot C, Lamolet B & Drouin J 1997 The bicoid-related homeoprotein Pitx1 defines the most anterior domain of the embryo and differentiates posterior from anterior lateral mesoderm. Development 124 2807–2817.[Abstract]

Lanctot C, Gauthier Y & Drouin J 1999 Pituitary homeobox 1 (Pitx1) is differentially expressed during pituitary development. Endocrinology 140 1416–1422.[Abstract/Free Full Text]

Melamed P, Koh M, Preklathan P, Bei L & Hew C 2002 Multiple mechanisms for Pitx-1 transactivation of a luteinizing hormone beta subunit gene. Journal of Biological Chemistry 277 26200–26207.[Abstract/Free Full Text]

Nordeen S 1988 Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 6 454–458.[Web of Science][Medline]

Parker KL, Ikeda Y & Luo X 1996 The roles of steroidogenic factor-1 in reproductive function. Steroids 61 161–165.[CrossRef][Web of Science][Medline]

Quentien MH, Manfroid I, Moncet D, Gunz G, Muller M, Grino M, Enjalbert A & Pellegrini I 2002 Pitx factors are involved in basal and hormone-regulated activity of the human prolactin promoter. Journal of Biological Chemistry 277 44408–44416.[Abstract/Free Full Text]

Quirk CC, Lozada KL, Keri RA & Nilson JH 2001 A single Pitx1 binding site is essential for activity of the LHbeta promoter in transgenic mice. Molecular Endocrinology 15 734–746.[Abstract/Free Full Text]

Rosenberg SB & Mellon PL 2002 An Otx-related homeodomain protein binds an LHbeta promoter element important for activation during gonadotrope maturation. Molecular Endocrinology 16 1280–1298.[Abstract/Free Full Text]

Sambrook J, Fritsch EF & Maniatis T 1989 Molecular Cloning: a Laboratory Manual. New York: Cold Spring Harbor Press.

Szeto DP, Rodriguez-Esteban C, Ryan AK, O’Connell SM, Liu F, Kioussi C, Gleiberman AS, Izpisua-Belmonte JC & Rosenfeld MG 1999 Role of the Bicoid-related homeodomain factor Pitx1 in specifying hindlimb morphogenesis and pituitary development. Genes and Development 13 484–494.[Abstract/Free Full Text]

Thomas P, Mellon PL, Turgeon J & Waring DW 1996 The L beta T2 clonal gonadotrope: a model for single cell studies of endocrine cell secretion. Endocrinology 137 2979–2989.[Abstract]

Tremblay JJ & Drouin J 1999 Egr-1 is a downstream effector of GnRH and synergizes by direct interaction with Pitx1 and SF-1 to enhance luteinizing hormone beta gene transcription. Molecular and Cellular Biology 19 2567–2576.[Abstract/Free Full Text]

Tremblay JJ, Lanctot C & Drouin J 1998 The pan-pituitary activator of transcription, Pitx1 (pituitary homeobox 1), acts in synergy with SF-1 and Pit1 and is an upstream regulator of the Lim-homeodomain gene Lim3/Lhx3. Molecular Endocrinology 12 428–441.[Abstract/Free Full Text]

Tremblay JJ, Marcil A, Gauthier Y & Drouin J 1999 Pitx1 regulates SF-1 activity by an interaction that mimics the role of the ligand-binding domain. EMBO Journal 18 3431–3441.[CrossRef][Web of Science][Medline]

Windle JJ, Weiner RI & Mellon PL 1990 Cell lines of the pituitary gonadotrope lineage derived by targeted oncogenesis in transgenic mice. Molecular Endocrinology 4 597–603.[Abstract/Free Full Text]

Wolfe MW 1999 The equine luteinizing hormone beta-subunit promoter contains two functional steroidogenic factor-1 response elements. Molecular Endocrinology 13 1497–1510.[Abstract/Free Full Text]

Wolfe MW & Call GB 1999 Early growth response protein 1 binds to the luteinizing hormone-beta promoter and mediates gonadotropin-releasing hormone-stimulated gene expression. Molecular Endocrinology 13 752–763.[Abstract/Free Full Text]

Zakaria MM, Jeong KH, Lacza C & Kaiser UB 2002 Pituitary homeobox 1 activates the rat FSHbeta (rFSHbeta) gene through both direct and indirect interactions with the rFSHbeta gene promoter. Molecular Endocrinology 16 1840–1852.[Abstract/Free Full Text]

Zhao L, Bakke M & Parker KL 2001 Pituitary-specific knockout of steroidogenic factor 1. Molecular and Cellular Endocrinology 185 27–32.[CrossRef][Web of Science][Medline]

Received 13 May 2005
Accepted 18 May 2005



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
S. P. Bliss, A. Miller, A. M. Navratil, J. Xie, S. P. McDonough, P. J. Fisher, G. E. Landreth, and M. S. Roberson
ERK Signaling in the Pituitary Is Required for Female But Not Male Fertility
Mol. Endocrinol., July 1, 2009; 23(7): 1092 - 1101.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. E. Walsh and M. A. Shupnik
Proteasome Regulation of Dynamic Transcription Factor Occupancy on the GnRH-Stimulated Luteinizing Hormone {beta}-Subunit Promoter
Mol. Endocrinol., February 1, 2009; 23(2): 237 - 250.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
J. Fortin, P. Lamba, Y. Wang, and D. J. Bernard
Conservation of mechanisms mediating gonadotrophin-releasing hormone 1 stimulation of human luteinizing hormone {beta} subunit transcription
Mol. Hum. Reprod., February 1, 2009; 15(2): 77 - 87.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Henke, C. Marc Luetjens, M. Simoni, and J. Gromoll
Chorionic Gonadotropin {beta}-Subunit Gene Expression in the Marmoset Pituitary Is Controlled by Steroidogenic Factor 1, Early Growth Response Protein 1, and Pituitary Homeobox Factor 1
Endocrinology, December 1, 2007; 148(12): 6062 - 6072.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld
Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks
Physiol Rev, July 1, 2007; 87(3): 933 - 963.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiang, Q.
Right arrow Articles by Halvorson, L. M
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, Q.
Right arrow Articles by Halvorson, L. M


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS