| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
1 Ushimado Marine Laboratory, Faculty of Science, Okayama University, Ushimado, Setouchi 701-4303, Japan
2 Faculty of Integrated Arts and Sciences, Hiroshima University, Kagamiyama, Higashi-Hiroshima 739-8521, Japan
3 School of Fisheries Sciences, Kitasato University, Sanriku, Ofunato 022-0101, Japan
4 Ocean Research Institute, University of Tokyo, Nakano, Tokyo 164-8639, Japan
(Requests for offprints should be addressed to T Sakamoto, Ushimado Marine Laboratory, Faculty of Science, Okayama University 130-17, Kashino, Ushimado, Setouchi, 701-4303, Japan; Email: ryu{at}uml.okayama-u.ac.jp)
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
PRL-releasing peptide (PrRP) is a peptide identified from mammalian hypothalamus with a specific PRL-releasing activity on pituitary cells (Hinuma et al. 1998, Sakamoto et al. 2003a). Concurrently, Fujimoto et al.(1998) isolated a homologue of PrRP from the Japanese crucian carp, Carassius auratus langsdorfii. Recently, homologues have also been isolated from tilapia and chum salmon, showing these peptides to be identical to the carp peptide (Moriyama et al. 2002, Seale et al. 2002). Although there are contradictory data on PRL-releasing effects in rats, PrRP appears to be a potent hypothalamic secretagogue for PRL as well as an inducer of PRL transcription in teleost pituitaries (Sakamoto et al. 2003a). On the other hand, both in fish and in mammals, PrRP appears to inhibit secretion of growth hormone (GH; Sakamoto et al. 2003a), another member of the hormone family sharing a common ancestral gene with PRL (Rand-Weaver et al. 1993). In mammals, PrRP is expressed in the central nervous system, but is also produced in the digestive tract, kidney, pancreas, adrenal gland, gonads and decidua (Fujii et al. 1999). Although PrRP is suggested to be a local stimulator of decidual PRL release in humans (Reis et al. 2002), the tissue distribution of PrRP in non-mammalian species is unknown.
In teleosts, the most prominent action of PRL is osmoregulation in fresh water. Among a number of activities associated with PRL through vertebrates, such osmoregulatory actions are considered by some to be the common and primary action of PRL throughout the vertebrates (Hirano 1986). For example, PRL caused several amphibians to move to an aquatic habitat (Warburg 1995). Mudskipper fishes (Perciformes; Gobioidei) are amphibious and euryhaline: they spend the greater parts of their lives out of water, and also maintain osmotic balance in hypotonic fresh water as well as in hypertonic sea water. Therefore, they provide a unique model for studies on osmoregulatory action of PRL under both terrestrial and aquatic conditions, and may be an evolutionary link between terrestrial and aquatic vertebrates for the existence of an extrapituitary PrRP–PRL axis.
Against this background, we thought that the analyses of expression profiles of PrRP and PRL in the various organs during adaptation of the mudskipper to different osmotic environments would give a clue to the relationships between PrRP and PRL. In the present study, we show the tissue distribution of mRNAs for mudskipper PrRP, PRL and GH, as well as the changes in their levels during the terrestrial adaptation and adaptation to different salinities by Northern blotting. In addition, we examined the cellular localization of immunoreactive PrRP and PRL mRNA in the intestine, an osmoregulatory organ, to ascertain the morphological basis for the innervation.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Adult mudskippers (Periophthalmus modestus) of both sexes weighing 4–6 g were obtained from the estuary of the Fujii River that pours into the Inland Sea of Seto. The fish were kept in the laboratory in tanks of isotonic one-third sea water (22–25 °C) for more than 1 week (Sakamoto et al. 2000a). A small plate floated in each tank so that the animals could climb onto this plate ad libitum. Freshly excised tissues for RNA extraction were immediately frozen in liquid nitrogen and then stored at – 80 °C.
Experimental protocol
The fishes were transferred from one-third sea water to either one-third sea water (control), fresh water (0 parts per thousand (ppt)), sea water (30 ppt) or to aquaria without water (n=4–6 per group). Fishes transferred to one-third sea water, fresh water, or sea water were sampled after 10 h and 1 week. Since previous studies reported that many physiological changes occurred approximately 10 h after water deprivation when fishes lose water to a 20% reduction of initial body mass (Gordon et al. 1978, Lee & Ip 1987, Sakamoto et al. 2002), the water-deprived fishes were sampled at this time point. This transfer study protocol was repeated three times and representative results are shown.
After quick blood collection by syringe from the hemal arch in the region of the caudal peduncle, the brain, pituitary, liver and gut were immediately removed, frozen in liquid nitrogen and then kept at – 80 °C. The plasma was stored at – 40 °C after centrifugation. To avoid stress, fish were anaesthetized with tricaine methane sulfonate before handling. All fish were kept, handled and used in accordance with Guidelines for Animal Experimentation of Okayama University.
RNA extraction
Total RNA was extracted from pituitaries by the method of Chomczynski & Sacchi (1987) using an RNA purification kit (Isogen; Wako Chemical, Osaka, Japan). Poly(A)+ RNA was obtained from other tissues by oligo(dT)–Sepharose chromatography using a Micro-prep RNA kit (Pharmacia) according to the manufacturer’s protocol. Each set of tissue samples was extracted at the same time to avoid procedure variability among the groups. The RNA was quantified by spectrophotometry.
PrRP cDNA probe
First-strand cDNA was reverse-transcribed from brain poly(A)+ RNA using the First Strand cDNA Synthesis kit (Pharmacia Biotech, Uppsala, Sweden). Following the manufacturer’s protocol, the primer 5'-GACCACGCG was used for reverse tran-TATCGATGTCGACT18-3' scription. One degenerate sense primer (5'-GA(TC) CC(AG)TTCTGGTA(CT)GTGG-3') designed based on the conserved regions of PrRPs, and an anchor primer (5'-GACCACGCGTATCGATGTCGAC-3') were used to clone the 3' partial region of mudskipper PrRP cDNA.
During PCR, the 50 µl reaction mixture (1 µl first-strand cDNA, 0.4 µM each sense and anchor primer, 0.2 mM nucleotide mix and 5 µl 10 x PCR buffer (final concentration, 10 mM Tris/HCl, pH 8.8, 50 mM KCl, 2.5 mM MgCl2, 1.5 units Gold-Taq DNA polymerase; PE Applied Biosystems, Chiba, Japan)) was subjected to 50 cycles of amplification. After activation of Taq polymerase at 95 °C for 10 min, each cycle consisted of a 1-min denaturation at 96 °C, 30-s primer annealing at 52 °C and 1-min primer extension at 73 °C. The final extension was 7 min at 72 °C.
A PCR-amplified cDNA product of expected size (363 bp) was observed after agarose gel electrophoresis (visualized by ethidium bromide staining). The DNA was extracted from the gels and ligated into pT7 Blue T-Vector (Novagen, Madison, WI, USA). Nucleotide sequencing of both strands was performed using an ABI DNA Sequencer 373 (Perkin-Elmer, Foster, CA, USA). Multiple clones were examined.
This partial sequence was identified as a PrRP cDNA fragment, because the optimized alignment of the corresponding regions of PrRP obtained from teleosts (Fujimoto et al. 1998, Moriyama et al. 2002, Seale et al. 2002) revealed 70% among the sequences, the topologies of the phylogenic trees of the aligned sequences were in accordance with the known phylogeny of teleosts (Clustal method) and the sequence did not match significantly other sequences deposited in the databases. The partial nucleotide and derived amino acid sequences of mudskipper PrRP are available from the GenBank nucleotide sequence database under accession no. AB089193 [GenBank] .
cDNA probes for GH and PRL
First-strand cDNA was reverse-transcribed from pituitary RNA using the First Strand cDNA Synthesis kit with the NotI-d(T)18 primer (Pharmacia). Degenerate sense and antisense primers were synthesized based on the most conserved regions of the sequence of known teleost PRLs or GHs to clone the internal region of mudskipper cDNAs encoding PRL and GH. During PCR of the first-strand cDNA, primers for PRL (5'-GACAA(AG)CT(GT)CACTC(ACT)CTCAG (ACTG)-3' (sense) and 5'-GCCCGGCA(ACGT)C(GT) (ACG)AG(GA)AC(CT)TT(CG)AGGAA-3' (antisense)) or GH (5'-CC(ACGT)AT(ACT)GA(CT)AA(AG)CA (CT)GA-3'(sense) and 5'-TC(AGTC)AC(TC)TT(AG) TGCAT(AG)TC-3' (antisense)), and KOD-Dash DNA polymerase (Toyobo, Osaka, Japan), in a 50 µl reaction mixture, were subjected to 30 cycles of amplification. Each cycle consisted of 1 min at 94 °C, 30 s at 54 °C and 90 s at 74 °C. PCR products of the expected size (497 bp for PRL or 314 bp for GH), which correspond to amino acid residues 40–205 of tilapia of PRL188 or 61–167 bonito GH (Rand-Weaver et al. 1993), were seen after agarose gel electrophoresis. The DNA was extracted from the gels and ligated into pT7 Blue T-Vector (Novagen). Nucleotide sequencing of both strands was performed using an ABI DNA Sequencer 373 (Perkin-Elmer). Multiple clones were examined. These sequences were identified as target cDNAs also based on the alignment of the perciform cDNAs (Rand-Weaver et al. 1993). The sequences of PRL and GH are available from the GenBank nucleotide sequence database under accession nos. AB089194 [GenBank] and AB089195 [GenBank] , respectively.
Northern blot analyses
The above mudskipper probes and cDNA of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were labeled with [
-32P]dCTP (random priming, BcaBEST DNA labeling kit; Takara, Otsu, Japan). Total RNA (2 µg) of the pituitary or poly(A)+ RNA (5 µg) of other tissues were size fractionated through a 1% agarose-formaldehyde gel and transferred onto a nylon membrane (Amersham) by capillary blotting (Sambrook et al. 1989). The RNA was covalently attached to the membane by baking at 80 °C for 2 h and by UV cross-linking. The membranes were hybridized with the probe for PrRP, PRL, GH or GAPDH for 18 h following prehybridization in Perfecthyb hybridization solution (Stratagene) according to the manufacturer’s instructions. The membranes were washed in 2 x SSC and 0.1% SDS at 65 °C for 2 x 10 min. They were washed again with 1 x SSC containing 0.1% SDS at 65 °C for 20 min, 0.1 x SSC containing 0.1% SDS for 2 x 20 min at 65 °C, and then rinsed at room tmperature. The membranes were exposed to phosphorimaging plate (Fuji imaging plate, Bas III; Fuji Film, Tokyo, Japan). Intensity of the hybridization signals was assessed with an Auto Image Analyser (Bas 2000; Fuji Film). After analysis of one of the messages, the membranes were dehybridized as described by the manufacturer followed by autoradiographies to check that the probes were removed. The membranes were then rehybridized to the other probes sequentially. Serial dilutions of the RNA demonstated linearity between hybridization signals and serial dilutions (results not shown). mRNA data are represented in arbitrary units normalized to the quantity of GAPDH signals, which were relatively constant, and pooled RNA was used as an internal standard to adjust the variability among the blots. Molecular sizes were estimated relative to migration of a RNA size marker (Toyobo).
PrRP–PRL localization in the gut
The mudskippers were kept in fresh water for 7 days (n=4), and the gut was fixed overnight in 4% paraformaldehyde in 0.1 M phosphate-buffer fixative (pH 7.4) at 4 °C. The anterior part of the intestine, where PrRP and PRL expression was abundant, as shown by Northern blots (results not shown), was dehydrated in ethanol and embedded in paraplast (Monoject; Sherwood Medical, St Louis, MO, USA). In the mudskipper, the oesophagus is connected directly to the proximal intestinal swelling. Two sagittal serial sections (5 µm on a microtome) were mounted separately on 3-aminopropyltriethoxysilane-coated slides.
Immunocytochemical staining of PrRP was carried out with anti-synthetic C-RFa serum using a Histofine immunostaining kit (Nichirei, Tokyo, Japan) basically as described by Moriyama et al.(2002). Anti-synthetic C-RFa serum was diluted 1:5000 with 0.1 M phosphate buffer (pH 7.4) containing 0.75% NaCl and 0.3% Triton X-100. To test the specificity of the immunoreaction, the adjacent sections were incubated with anti-synthetic C-RFa serum that was preabsorbed overnight at 4 °C with excess synthetic C-RFa (1 µg peptide in 1 ml antiserum).
For in situ hybridization of PRL mRNA, the fluoroscein-labelled oligonucleotide probe against mud-skipper PRL (5'-GACACTTGGAGAGCCTGGTCTT TGTC AGTAGGACCTTGCAGATTGGACG(FITC-dT)(FITC-dT)(FITC-dT)-FITC-3') was synthesized commercially (Amersham Pharmacia Biotech, Tokyo, Japan). Hybridization and washes were performed in the dark according to Hyodo & Urano (1991). In brief, following prehybridization for 1 h, hybridization was carried out at 37 °C for 16 h with 500 ng/ml probe disolved in the hybridization medium containing 20 mM Tris/HCl (pH 7.5), 6 mM EDTA, 0.6 M NaCl, 10% dextran sulfate, 1 x Denhardt’s solution, 0.5 mg/ml calf thymus DNA and 40% deionized formamide. The slides were washed at a final stringency of 30% formamide/1 x SSC at 37 °C. Control slides for specificity were hybridized with excess (4000-fold) unlabelled probe. The sections were mounted in Gel/Mount (Biomedia, Foster, CA, USA) and observed using a fluorescence microscope (EFD2 with Hg 100 W light source; Nikon, Tokyo, Japan) equipped with a chilled CCD camera (C5985; 756 x 483 x 8 bit; Hamamatsu Photonics, Hamamatsu, Japan).
Plasma ion analyses
Plasma Na+ (an indicator of plasma osmolality) was determined by atomic absorption spectrophotometry (Z5300; Hitachi, Tokyo, Japan).
Statistics
All data are presented as means ± S.E.M. Statistical significance of differences among mean values was tested using an ANOVA followed by the least significant difference test with Statview 4.11 (Abacus Concepts).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Transcripts of PrRP at about 1.7 and/or 3 kb were abundantly expressed in the brain, liver, gut and ovary (Fig. 1
), while signals were also observed in the skin and kidney. As for PRL mRNA, the apparent positive signals at about 2.7 kb were detected in the liver, gut and ovary, in addition to the highest level of expression in the pituitary (about 1.6 and 2.7 kb). We could also detect signals for extrapituitary GH transcripts (2.2 and 3.5 kb) in the liver, gut and ovary, in addition to the highest pituitary level (1.5, 2.2 and 3.5 kb). The low levels of the extrapituitary signal were not due to blood-cell contamination, as no significant amount of RNA was extracted from blood.
|
When mudskipper were transferred to fresh water, the plasma sodium levels decreased significantly after 10 h (P<0.05), and returned to a similar level to that in one-third sea water after 1 week. There was no significant difference in plasma sodium during adaptation to other environments, although a 20% increase was observed in fish kept out of water (Fig. 2).
|
), PrRP mRNA levels increased under terrestrial conditions (P<0.05). After 1 week, the brain PrRP mRNA in freshwater fish was higher than that in sea-water fish (P<0.05). PRL mRNA levels in the pituitary increased after transfer to fresh water and the value of the 1-week group was significantly different (P<0.01). The pituitary PRL mRNA was also elevated under terrestrial conditions (P<0.05). On the other hand, GH mRNA levels in the pituitary increased progressively after sea-water transfer and the increase became significant after 1 week (P<0.05).
|
). In the gut (Fig. 5), mRNA levels of both PrRP and PRL in freshwater fish were higher than those in sea-water fish and the levels of the 1-week group were significantly different (P<0.05). The gut GH mRNA increased 1 week after fresh-water transfer (P<0.05).
|
|
Figure 6A shows specific immunoreactive PrRP in the anterior intestine of freshwater-adapted mudskipper. Immunoreactive PrRP was observed in the epithelial cells, especially in the cytoplasm of mucous cells. Little immunoreactivity was found in the controls performed to validate the specificity of the immunoreaction (results not shown).
|
. The hybridization signals were largely located in the PrRP-immunoreactive cells. Some signals were also detected in the lamina propria; however, these signals were differently coloured, not abolished by addition of an excess unlabelled probe, and these seem to be due to the autofluorescence of the blood cells (results not shown). No differences in the distribution of immunoreactive PrRP or signals for PRL mRNA were seen among the different samples. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
The abundant expression of PrRP was observed in the brain, liver, gut and ovary in mudskipper, while less-abundant levels were also detected in the skin and kidney. In rat, PrRP mRNA expression was detected in the thyroid gland, trachea, submandibular gland, pancreas, gut, and reproductive organs in addition to the central nervous system. Among human peripheral tissues, the relatively high levels of PrRP mRNA were detected in the pancreas (Fujii et al. 1999). Although it is unknown whether the liver of mudskipper is a hepatopancreas, the hybridization band in the liver may be due to the pancreatic tissues.
Corresponding to the distribution of PrRP mRNA in the mudskipper, relatively high expression of extrapituitary PRL mRNA was observed in the liver, gut and ovary. Since such high extrapituitary expression has been reported only in teleosts such as rainbow trout, goldfish and other perciforms (Santos et al. 1999, Yang et al. 1999, Imaoka et al. 2000), production of PRL might be centralized into pituitary during terrestrial tetrapod evolution. The larger size of extrapituitary PRL transcripts may reflect a difference of promoter usage as reported in mammalian lymphocytes and decidua, whose RNA transcripts are larger than the pituitary counterpart (Ben-Jonathan et al. 1996). GH gene expression was also detectable in these organs as in salmonid fishes (Yang et al. 1999).
During adaptation of the mudskipper to different environments, the changes in mRNA levels of PrRP and PRL paralleled in the brain-pituitary, liver, and gut. PrRP mRNA in the brain and the pituitary PRL mRNA increased under 10 h terrestrial conditions, indicating the activation of the brain-pituitary axis of PrRP–PRL during terrestrial adaptation and perhaps the relative importance of the pituitary PRL in terrestrial vertebrates. The increased plasma levels of sodium/osmolality and cortisol during terrestrial adaptation (Sakamoto et al. 2002; Fig. 2) have been known to suppress PRL expression in teleosts (Sakamoto et al. 2003a). Under terrestrial conditions, the brain PrRP seems to importantly induce pituitary PRL. The induced pituitary PRL, as circulating PRL, may stimulate a preference for an aquatic habitat as observed in some amphibians. Indeed, when Xenopus was kept out of the water PRL was synthesized (Warburg 1995). The brain PrRP and pituitary PRL mRNAs increased after 1 week in fresh water as well, demonstrating that the brain-pituitary axis also operates in fresh water. The pituitary PRL may decrease the integumental permeability in order to maintain the electrolytes in fresh water and the water in terrestrial environment. We have shown that the tissue resistance in the chloride-secreting skin of mudskipper increased during fresh-water adaptation and terrestrial adaptation, although chloride secretion diminished only during fresh-water adaptation (Sakamoto et al. 2000b). Actually, the primary action of PRL has been suggested to be the reduction in ion and water permeability of osmoregulatory surfaces without affecting their ion-transporting capacities (Hirano 1986). On the other hand, GH mRNA levels in the pituitary were elevated 1 week after sea-water transfer, consistent with the indirect inhibition of pituitary GH expression by brain PrRP (Sakamoto et al. 2003a). A sea-water-adapting action of GH in mudskippers appears to be similar to that reported in several teleosts such as salmonids, tilapia and killifish (Sakamoto et al. 1993, 1997, 2001).
Expressions of PrRP and PRL in the gut of freshwater fish were higher than those in sea-water fish after 1 week, although there was no change in fish kept out of water. Therefore, the axis in the gut operates specifically during fresh-water adaptation. In the gut, PrRP and PRL seem to be co-localized in the intestinal epithelia, especially in the mucus cells, contrary to the presence of PrRP mRNA in the lamina propria and the effects of PrRP on motor function in rat intestines (Roland et al. 1999, Grabauskas et al. 2004). In the intestinal epithelia, PrRP may stimulate PRL expression in an autocrine manner as observed in human dicidua (Reis et al. 2002). The induction of intestinal PRL in fresh water may have relevant implications. Specifically during fresh-water adaptation, intestinal PRL may participate locally in the epithelial (mucus) cell growth and/or in the inhibition of apoptosis, since the gut mucus cells are numerous in fresh-water fish, but not in sea-water fish (Yamamoto & Hirano 1978). A large number of PRL’s actions are associated with cell proliferation and/or apoptosis, and PRL has been shown to induce the hypertrophy of the intestinal mucosa in birds and mammals as well as the mucous cell size and number in fish gills (Bole-Feysot et al. 1998, Sakamoto et al. 2005). In the intestinal mucus cells of tilapia, PRL receptor mRNA has been clearly observed (Sandra et al. 2000). PrRP has also been suggested to promote growth and survival of PRL-producing cells (Duval & Gutierrez-Hartmann 2002), i.e. the mucus cells in the intestine. Furthermore, the increased expression of gut GH in fresh water may also be involved in the growth and differentiation of particular cells.
In the liver, no significant change was seen in PrRP, PRL or GH, suggesting their minor role during adaptation to different environments. The variation among organs may reflect the functional versatility of PrRP–PRL axis (Hirano 1986, Sakamoto et al. 2003a). Future studies should determine the effect of PrRP in the control of extrapituitary PRL production using the neutralizing antibodies or antisense oligonucleotides possibly with in vitro preparations.
In conclusion, we have shown that PrRP and PRL are co-expressed in some organs in a teleost during adaptation to different environments, suggesting that PrRP regulates PRL expression at the peripheral organs as well as at the pituitary. The possible presence of PrRP–PRL axes in the peripheral organs adds a new candidate for a specific local modulator of extrapituitary PRL, suggesting an ancient history of this axis prior to the evolution of the hypothalamus-pituitary. PrRP might be an original, fundamental regulator of PRL.
|
Acknowledgements |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Bole-Feysot C, Goffn V, Edery M, Binart N, & Kelly PA 1998 Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocrine Reviews 19 225–268.
Chomczynski P & Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chlorophorm extraction. Analytical Biochemistry 162 156–159.[ISI][Medline]
Duval DL & Gutierrez-Hartmann A 2002 PRL-releasing peptide stimulation of PRL gene transcription–enter AKT. Endocrinology 143 11–12.
Fujii R, Fukusumi S, Hosoya M, Kawamata Y, Habata Y, Hinuma S, Sekiguchi M, Kitada C, Kurokawa T, Nishimura O et al. 1999 Tissue distribution of prolactin-releasing peptide (PrRP) and its receptor. Regulatory Peptides 83 1–10.[CrossRef][ISI][Medline]
Fujimoto M, Takeshita K, Wang X, Takabatake I, Fujisawa Y, Teranishi H, Ohtani M, Muneoka Y & Ohta S 1998 Isolation and characterization of a novel bioactive peptide, Carassius RF-amide (C-RFa), from the brain of the Japanese crucian carp. Biochemical and Biophysical Research Communications 242 436–440.[CrossRef][ISI][Medline]
Goffn V, Binart N, Touraine P & Kelly PA 2002 Prolactin: the new biology of an old hormone. Annual Review of Physiology 64 47–67.[CrossRef][ISI][Medline]
Gordon MS, Ng WWS & Yip AYW 1978 Aspect of the physiology of terrestrial life in amphibious fishes. Journal of Experimental Biology 72 57–75.
Grabauskas G, Zhou SY, Das S, Lu Y, Owyang C & Moises HC 2004 Prolactin-releasing peptide affects gastric motor function in rat by modulating synaptic transmission in the dorsal vagal complex. Journal of Physiology 561 821–839.
Hinuma S, Habata Y, Fujii R, Kawamata Y, Hosoya M, Fukusumi S, Kitada C, Masuo Y, Asano T, Matsumoto H et al. 1998 A prolactin-releasing peptide in the brain. Nature 393 272–276.[CrossRef][Medline]
Hirano T 1986 The spectrum of prolactin action in teleosts. Progress in Clinical and Biological Research 205 53–74.[Medline]
Hyodo S & Urano A 1991 Changes in expression of provasotocin and proisotocin genes during adaptation to hyper- and hypo-osmotic environments in rainbow trout. Journal of Comparative Physiology B 161 549–556.[CrossRef][Medline]
Imaoka T, Matsuda M & Mori T 2000 Extrapituitary expression of the prolactin gene in the goldfish, African clawed frog and mouse. Zoological Science 17 791–796.
Lee CGL & Ip YK 1987 Na+, K+ and volume regulation in the mudskipper Periophthalmus chrysospilos. Comparative Biochemistry and Physiology A 87 439–448.
Moriyama S, Ito T, Takahashi T, Amano M, Sower SA, Hirano T, Yamamori K & Kawauchi H 2002 A homologue of mammalian prolactin-releasing peptide (fish arginyl-phenylalanyl-amide peptide) is a major hypothalamic peptide of prolactin release in teleost fish. Endocrinology 143 2071–2079.
Rand-Weaver M, Kawauchi H & Ono M 1993 Evolution of the structure of the growth hormone and prolactin family. In The Endocrinology of Growth, Development, and Metabolism in Vertebrates, pp 13–42. Eds MP Schreibman, CG Scanes & PKT Pang. New York: Academic Press.
Reis FM, Vigano P, Arnaboldi E, Spritzer PM, Petraglia F & Di Blasio AM 2002 Expression of prolactin-releasing peptide and its receptor in the human decidua. Molecular Human Reproduction 8 356–362.
Roland BL, Sutton SW, Wilson SJ, Luo L, Pyati J, Huvar R, Erlander MG & Lovenberg TW 1999 Anatomical distribution of prolactin-releasing peptide and its receptor suggests additional functions in the central nervous system and periphery. Endocrinology 140 5736–5745.
Sakamoto T, McCormick SD & Hirano T 1993 Osmoregulatory actions of growth hormone and its mode of action in salmonids: A review. Fish Physiology and Biochemistry 11 155–164.[CrossRef][ISI]
Sakamoto T, Shepherd BS, Madsen SS, Nishioka RS, Siharath K, Richman NHI, Grau EG & Bern HA 1997 Osmoregulatory actions of growth hormone and prolactin in an advanced teleost. General and Comparative Endocrinology 106 95–101.
Sakamoto T, Yokota S & Ando M 2000a Rapid morphological oscillation of mitochondrion-rich cell in estuarine mudskipper following salinity changes. Journal of Experimental Zoology 286 666–669.
Sakamoto T, Agustsson T, Björnsson BTh & Ando M 2000b Roles of growth hormone and prolactin during adaptation of the gobies to various environments. In Growth and Growth Regulation in Fish, pp 29–32. Eds Th Bjornsson & D MacKinlay. Vancouver: American Fisheries Society.
Sakamoto T, Uchida K & Yokota S 2001 Regulation of the ion-transporting mitochondrion-rich cell during adaptation of teleost fishes to different salinities. Zoological Science 18 1163–1174.[CrossRef][ISI][Medline]
Sakamoto T, Yasunaga H, Yokota S & Ando M 2002 Differential display of skin mRNAs regulated during adaptation of mudskipper to different environments. Journal of Comparative Physiology B 172 447–453.[CrossRef][Medline]
Sakamoto T, Fujimoto M & Ando M 2003a Fishy tales of prolactin-releasing peptide. International Review of Cytology 225 91–130.[ISI][Medline]
Sakamoto T, Agustsson T, Moriyama S, Takahashi A, Kawauchi H, Björnsson BTh & Ando M 2003b Intraarterial injection of prolactin-releasing peptide elevates prolactin gene expression and plasma prolactin levels in rainbow trout. Journal of Comparative Physiology B 173 333–337.[CrossRef][Medline]
Sakamoto T, Oda A, Narita K, Takahashi H, Oda T, Fujiwara J & Godo W 2005 Prolactin: fishy tales of its primary regulator and function. Annals of the New York Academy of Sciences (in press).
Sambrook J, Fritcsh EF & Maniatis T 1989 Molecular Cloning: a Laboratory Manual with the Laboratory Manual Source Book. Cold Spring Harbor: Cold Spring Harbor Press.
Sandra O, Le Rouzic P, Cauty C, Edery M & Prunet P 2000 Expression of the prolactin receptor (tiPRL-R) gene in tilapia Oreochromis niloticus: tissue distribution and cellular localization in osmoregulatory organs. Journal of Molecular Endocrinology 24 215–224.[Abstract]
Santos CR, Ingleton PM & Power DM 1999 Cloning, characterization, and tissue distribution of prolactin receptor in the sea bream (Sparus aurata). General and Comparative Endocrinologym 114 57–66.
Seale AP, Itoh T, Moriyama S, Takahashi A, Kawauchi H, Sakamoto T, Fujimoto M, Riley LG, Hirano T & Grau EG 2002 Isolation and characterization of a homologue of mammalian prolactin-releasing peptide from the tilapia brain and its effect on prolactin release from the tilapia pituitary. General and Comparative Endocrinology 125 328–339.[CrossRef][ISI][Medline]
Wang X, Morishita F, Matsushima O & Fujimoto M 2000 Immunohistochemical localization of C-RFamide, a FMRF-related peptide, in the brain of the goldfish, Carassius auratus. Zoological Science 17 1067–1074.
Warburg MR 1995 Hormonal effect on the osmotic, electrolyte and nitrogen balance in terrestrial Amphibia. Zoological Science 12 1–11.
Yamamoto M & Hirano T 1978 Morphological changes in the esophageal epithelium of the eel, Anguilla japonica, during adaptation to seawater. Cell Tissue Research 192 25–38.[ISI][Medline]
Yang BY, Greene M & Chen TT. 1999 Early embryonic expression of the growth hormone family protein genes in the developing rainbow trout, Oncorhynchus mykiss. Molecular Reproduction and Development 53 127–134.[CrossRef][ISI][Medline]
Received 21 February 2005
Accepted 28 February 2005
Made available online as an Accepted Preprint 8 March 2005
This article has been cited by other articles:
|
|
 |
|
  S. P. Kelly and R. E. Peter Prolactin-releasing peptide, food intake, and hydromineral balance in goldfish Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2006; 291(5): R1474 - R1481. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
