HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lewis, J. S Articles by Thomas, T. Search for Related Content PubMed PubMed Citation Articles by Lewis, J. S Articles by Thomas, T.

¹ Department of Medicine and
² Department of Environmental and Occupational Medicine, University of Medicine and Dentistry of New Jersey – Robert Wood Johnson Medical School, New Brunswick, NJ 08903, USA
³ Environmental and Occupational Health Sciences Institute and
⁴ Department of Oncology, Lombardi Cancer Center, Georgetown University, Washington DC 20057, USA
⁵ The Cancer Institute of New Jersey, New Brunswick, New Jersey 08903, USA

(Requests for offprints should be addressed to T Thomas, Clinical Academic Building, Room 7092, UMDNJ – Robert Wood Johnson Medical School, 125 Paterson Street, New Brunswick, New Jersey 08903, USA; Email: thomasth{at}UMDNJ.edu)

	Abstract

Top Abstract Introduction Materials and methods Results Discussion References

 
We studied the effects of 2-methoxyestradiol (2-ME₂) and 16-hydroxyestrone (16-OHE₁), two metabolites of estradiol (E₂), on DNA synthesis, cell cycle progression and cyclin D1 protein levels in estrogen receptor-positive MCF-7 cells. E₂ and 16-OHE₁ stimulated DNA synthesis, and 2-ME₂ inhibited the stimulatory effects of these agents. E₂ and 16-OHE₁ stimulated the progression of cells from G₁ to S phase and this effect was attenuated by 2-ME₂. Western blot analysis showed that E₂ and 16-OHE₁ increased cyclin D1 protein level by about fourfold compared with control. 2-ME₂ had no significant effect on cyclin D1; however, it prevented the accumulation of cyclin D1 in the presence of E₂ and 16-OHE₁. Cells transfected with a cyclin D1 reporter gene and treated with E₂ or 16-OHE₁ showed 7- and 9.5-fold increase respectively in promoter activity compared with control. This activity was significantly inhibited by 2-ME₂. Cyclin D1 transactivation was mediated by the cAMP response element (CRE) region, which binds activating transcription factor 2 (ATF-2). DNA affinity assay showed 2.5- and 3.5-fold increases in ATF-2 binding to CRE in the presence of E₂ and 16-OHE₁ respectively. The binding of ATF-2 was inhibited by the presence of 2-ME₂. These results show that 2-ME₂ can downregulate cyclin D1 and thereby cell cycle progression by a mechanism involving the disruption of ATF-2 binding to cyclin D1 promoter.

	Introduction

Top Abstract Introduction Materials and methods Results Discussion References

 
The female sex hormone estradiol (E₂) plays a major role in the development and progression of breast cancer (Henderson et al. 1988, Russo et al. 2003). E₂ exerts its biologic effects through the estrogen receptors (ERand ERß), ligand-activated transcription factors present in target tissues (Katzenellenbogen et al. 2000, McKenna & O’Malley 2002, Thomas et al. 2004). In general, estrogenic action involves the binding of the ligand to the ER, which undergoes conformational changes and dimerization, and is recognized by the estrogen response element (ERE), located at the promoter region of estrogen-responsive genes. The ER–ERE interaction triggers a cascade of cellular events, leading to the transcriptional activation of specific genes responsible for cell proliferation (Nilsson & Gustafsson 2002).

E₂ is metabolized by oxidation and hydroxylation (Martucci & Fishman 1993, Zhu & Conney 1998). The oxidation product of E₂ is estrone (E₁), which is metabolized by two mutually exclusive hydroxylation pathways: hydroxylation at the C-2 or the 16 position (Fig. 1). Hydroxylation at the C-2 position yields 2-hydroxyestrone (2-OHE₁) and 2-hydroxyestradiol (2-OHE₂), whereas hydroxylation at the 16 position yields 16-hydroxyestrone (16-OHE₁) and 16- hydroxyestradiol (16-OHE₂). Increased 16-hydroxylation in women is associated with increased breast cancer risk (Muti et al. 2000). 16-Hydroxylated metabolites stimulate breast cancer cell growth, whereas the 2-hydroxylated estrogens inhibit cell growth (Ball et al. 1972, Seegers et al. 1989, Lottering et al. 1992, Zhu & Conney 1998). 2-OHE₁ and 2-OHE₂ are rapidly converted to the monomethyl ethers, 2-ME₁ and 2-ME₂ respectively by the enzyme catechol-O-methyltransferase (COMT) (Ball et al. 1972, Jefcoate et al. 2000). 2-ME₂ inhibits the growth of human mammary cancer cells in vitro and in vivo (Lottering et al. 1992, Fotis et al. 1994). The binding affinity 2-ME₂ for ER from MCF-7 cells is about 1% of that of E₂ (Brueggemeier et al. 2001). Low concentrations (10 nM) of 2-ME₂ inhibit the growth of ER-positive MCF-7 cells, and cause fluctuations in cAMP levels, whereas pharmacologic concentrations (1–10 µM) inhibit tubulin polymerization and angiogenesis (Lottering et al. 1992, D’Amato et al. 1994, Cushman et al. 1995, Klauber et al. 1997, Moobery 2003).

View larger version (20K): [in this window] [in a new window]   Figure 1 Pathways of cellular metabolism of estradiol (E2). E2 metabolism occurs primarily through three pathways: C2-hydroxylation (major pathway), C16-hydroxylation (major pathway) and C4-hydroxylation (minor pathway). 2-Hydroxyestradiol (2-OHE2) is further O-methylated by catechol-O-methyltransferase (COMT) to form 2-methoxyestradiol 2-ME2.

Cyclin D1 is an important regulator of G₁S phase transition, and its expression in breast cancer cells is sensitive to estrogens and antiestrogens (Musgrove et al. 1994, Altucci et al. 1996, Foster & Wimalasena 1996, Pacilio et al. 1998, Pestell et al. 1999). In transgenic mice, overexpression of cyclin D1 led to the development of mammary tumors, while cyclin D1 knockout mice showed impaired development of mammary glands (Wang et al. 1994, Sicinski & Weinberg 1997). The promoter region of cyclin D1 contains binding sites for AP1, SP1, NF-B and ATF/CREB, all of which are implicated in its transcriptional activation (Herber et al. 1994, Albanese et al. 1995, Watanabe et al. 1998, Bromberg et al. 1999, Guttridge et al. 1999). Recent studies indicate that E₂ regulation of cyclin D1 in MCF-7 cells occurs at the transcriptional level, and involves the cAMP response element (CRE) (Altucci et al. 1996, Sabbah et al. 1999). The CRE element binds bZIP DNA-binding proteins belonging to the ATF/CREB family of transcription factors (Hai et al. 1993). ATF-2 is a member of the ATF/CREB family, and stimulates the transcription of cyclin D1 (Beier et al. 1999, Sabbah et al. 1999). The ability of ATF-2 to bind to the CRE and stimulate CRE-mediated transcription is regulated by phosphorylation (Gupta et al. 1995).

In the present study, we examined the effects of E₂, 16-OHE₁ and 2-ME₂ on DNA synthesis and cell cycle progression, cyclin D1 transactivation and ATF-2 DNA-binding activity in MCF-7 breast cancer cells. Our results showed that 2-ME₂ interfered with the growth stimulatory effects of E₂ and 16-OHE₁, as did the pure antiestrogen, ICI 182,780. In transient transfection assays, E₂ and 16-OHE₁ enhanced cyclin D1 promoter activity, while 2-ME₂ and ICI 182,780 inhibited this effect. The estrogenic effect on cyclin D1 was mediated through the binding of ATF-2 to the CRE site.

	Materials and methods

Top Abstract Introduction Materials and methods Results Discussion References

 
Chemicals, reagents and antibodies

E₂, 16-OHE₁ and 2-ME₂ were purchased from Steraloids (Wilton, NH, USA). The pure antiestrogen ICI 182,780 was purchased from Tocris (Ellisville, MO, USA). Monoclonal antihuman ATF-2, phospho-ATF-2, CREB, ATF-1, c-Jun, c-Fos, p65, p50, p38 and phospho-p38 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Mono-clonal anti-cyclin D1 antibody was from LabVision (Fremont, CA, USA). DMEM, phenol red-free DMEM and fetal bovine serum were purchased from Sigma. The HexaPlus DNA labeling kit was obtained from MBI Fermentas (Amherst, NY, USA). Antibiotics, trypsin and other additives for cell culture were purchased from Gibco Laboratories (Grand Island, NY, USA). Dynabeads M-280, Streptavidin and Dynal MPC-S were obtained from Dynal Biotechnology (Lake Success, NY, USA). Biotin-16–2'-deoxyuridine-5'-triphosphate (Biotin-16-dUTP) was purchased from Sigma.

Oligonucleotides and plasmids

HPLC-purified oligonucleotides (ODNs) were purchased from Oligos, Etc (Wilsonville, OR, USA). A 74-bp ODN1, with cyclin D1 promoter sequence (–78 to –5) containing the consensus CRE (underlined) and NF-B response element (boldface) was used for DNA affinity assays. A mutated CRE/ATF ODN2 with a three-base rearrangement in the consensus sequence (underlined and boldface) was used for determining sequence specificity of the CRE/ATF-2 binding. The base sequence of the top strands of the ODNs used in this study are as follows:

ODN1: 5'-GGGCTTTGATCTTTGCTTAACAAC AGTAACGTCACACGGACTACAGGGGAGTTTTG TTGAAGTTGCAAAGTCCT-3'

ODN2: 5'GGGCTTTGATCTTTGCTTAACAAC AGTAGCGGCACACGGACTACAGGGGAGTTTT GTTGAAGTTGCAAAGTCCT-3'

For transcriptional activation studies, the cyclin D1 luciferase reporter plasmids -1745CD1-LUC, -1745 ATF/CREmut-LUC, -964CD1-LUC, -964AP1 mut-LUC, -66CD1-LUC, -66 ATF/CREmut-LUC and -66CD1Bmut-LUC were used. These reporter gene constructs have been previously described (Albanese et al. 1995, Watanabe et al. 1999). A mutant and wild-type human ATF-2 cDNA, subcloned into the eukaryotic expression vector pCMV, was used to express ATF-2 dominant negative mutant (ATF-2 dom neg mutant) and wild-type proteins in transfected cells (Lee et al. 1999, D’Amico et al. 2000). The pRL-SV40 vector (Promega) containing the Renilla luciferase gene was used as an internal control.

Cell culture methods

MCF-7 cells were obtained from the American Type Culture Collection (Rockville, MD, USA). Cells were maintained in DMEM, supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin, 40 µg/ml genta-micin, 2 µg/ml insulin, 0.5 mM sodium pyruvate, 50 mM nonessential amino acids, 2 mM L-glutamine and 10% fetal bovine serum. Two weeks before each experiment, MCF-7 cells were grown in phenol red-free DMEM containing serum treated with dextran-coated charcoal (DCC) to remove serum-derived estrogenic compounds (Berthois et al. 1986, Thomas et al. 1989, Lewis et al. 2001). DCC suspension contained 0.05% dextran, 0.5% charcoal and 25 mM sucrose. Serum was subjected to three 10-min cycles of DCC treatment, centrifugation and filtering through a 0.2 µm membrane.

For [³H]thymidine incorporation assay, MCF-7 cells (0.5 x 10⁶) were seeded in 35 mm culture dishes in phenol red-free DMEM supplemented with DCC-treated serum and additives. After 24 h of plating, cells were treated with 10 nM E₂, 16-OHE₁ or 2-ME₂, as indicated in the text. Control cells received ethanol vehicle, which was maintained at less than 0.1%. DNA synthesis was measured by adding 4 µCi/ml [³H]thymidine to cells 1 h before harvest. Cells were washed twice with ice-cold PBS and treated with ice-cold 5% trichloroacetic acid. The cell layer was then solubilized in 1 M NaOH and neutralized with 1 M HCl. The radioactive thymidine incorporated in cellular DNA was quantified by liquid scintillation counting.

For cell cycle analysis, MCF-7 cells (2x10⁶) were seeded in 100 mm culture dishes for 24 h and then treated with E₂, 16-OHE₁, 2-ME₂ or ICI 182,780 for 24 and 48 h. Triplicate plates from each treatment group were washed with PBS and covered with a buffer containing 40 mM sodium citrate, 250 mM sucrose and 5% DMSO, and stored at –70 °C. On the day of DNA analysis, cells were thawed, and the citrate buffer was removed. Cells were trypsinized for 10 min and then treated with a solution containing a trypsin inhibitor and RNase for 10 min. Cells were then stained by adding propidium iodide solution in sodium citrate buffer and analyzed by a Coulter flow cytometer. Percentage distribution of cells in different phases of cell cycle was calculated with cytologic software (Thomas & Thomas 1994).

Western blot analysis

Cyclin D1 protein levels in MCF-7 cells were determined by Western blot, after treatment with E₂, 16-OHE₁, 2-ME₂ or ICI 182,780. Cell lysate was prepared by the procedure previously described (Thomas & Thomas 1994). Briefly, monolayers of cells were washed twice with ice-cold PBS, and lysed by the addition of ice-cold lysis buffer (150 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 2 mM EDTA, 50 mM sodium fluoride, 0.2% SDS, 1 mM sodium vanadate, 2 µg/ml leupeptin, aprotonin and pepstatin, and 1 mM phenylmethylsulfonyl fluoride). An amount of 30 µg protein was diluted in 2xSDS–PAGE Laemmli buffer (150 mM Tris base (pH 6.8), 30% glycerol, 4% SDS, 7.5 mM dithiothreitol and 0.01% bromophenol blue) and separated on 10% SDS-polyacrylamide gel. Proteins were transferred to PVDF Polyscreen membranes, which were incubated in 5% nonfat milk in Tris–buffered saline, containing 0.1% Tween-20 for 1 h. Membranes were then incubated overnight with a 1:200 dilution of antibodies specific to human cyclin D1, phospho-p38 MAPK (activated) or p38 MAPK (total) respectively. Protein bands were visualized with horse-radish peroxidase-conjugated secondary antibody with a chemiluminescence-based detection system. Membranes were stripped and reblotted with anti-ß-actin mono-clonal antibody (1:5000). Intensity of protein bands was quantified with a Scanjet 4C flatbed scanner (Hewlett Packard) with NIH Image v1.52 software. Lightly exposed films were used for quantification.

Transient transfection assay

MCF-7 cells (1x10⁵) were plated in 24-well microtiter plates for 24 h. By the calcium phosphate coprecipitation procedure (Mamalian Transfection Kit; Clontech, Palo Alto, CA, USA), cells were transfected with 4 µg cyclin D1 promoter plasmid linked to a firefly luciferase reporter gene and 0.4 µg Renilla luciferase plasmid (Shah et al. 2001). In some experiments, cells were also transfected with 1–10 µg ATF-2 dominant negative mutant expression vector (pCMV). After transfection, the medium was refreshed, and cells were treated with 10 nM E₂, 16-OHE₁ or 2-ME₂, or 100 nM ICI 182,780 for 7 h. The activities of the cyclin D1 firefly reporter gene and the Renilla luciferase internal control were determined in a dual luciferase reporter assay system (Promega). Reporter activity was normalized for each sample by the following formula: normalized luciferase activity=firefly luciferase activity/Renilla luciferase activity.

DNA affinity immunoblot assay

Treatments and preparation of cellular extracts were as described under Western blot analysis.

ODNs were biotinylated with the HexaLabel Plus DNA labeling kit. Biotinylated ODNs (1 µM) were immobilized by incubating with the Dynabeads (1 mg/ml) in TE buffer (10 mM Tris–HCl, pH 7.5, 1 mM EDTA, 1 M NaCl) for 15 min at 22 °C. The Dynabeads containing the immobilized biotinylated DNA were washed, separated in Dynal MPC-S and incubated with cellular extract (100 µg) in 8 mM Tris–phosphate at pH 7.4, 0.12 M KCl, 8% glycerol, 4 mM DTT and 0.5% CHAPS for 1 h at 4 °C (Zwijsen et al. 1998). Subsequently, beads were washed in 10 mM HEPES at pH 7.7, 50 mM KCl, 20% glycerol and 0.1% NP-40, and boiled in Laemmli buffer (100 µl), and the DNA-bound proteins were separated on 10% polyacrylamide gel. Proteins were identified by immunoblotting with antibodies specific for ATF-2, phospho-ATF-2, ATF-1, c-Fos, c-Jun, CREB or p65. Membranes were stripped and reprobed, using an antibody to a transcription factor (p50), which did not show any change with treatments, as a control for equal loading and transfer.

Statistical analysis

Results of transient transfection studies are presented as mean ± S.E. for at least three separate experiments. Statistical difference between control and treatment groups was determined by one-way ANOVA followed by Dunnet’s post-test (GraphPad Prism Software program, San Diego, CA, USA). A P value of <0.05 was considered to be statistically significant.

	Results

Top Abstract Introduction Materials and methods Results Discussion References

 
Effects of E₂, 16-OHE₁ and 2-ME₂ on DNA synthesis and cell cycle

In the first set of experiments, we tested the effects of 10 nM E₂, 16-OHE₁ and 2-ME₂ on DNA synthesis in MCF-7 breast cancer cells by the [³H] thymidine incorporation assay. A concentration of 10 nM was used to observe maximal effects of E₂ and 16-OHE₁ (Lewis et al. 2001) and to avoid the cytotoxic effects of 2-ME₂ observed at µM concentrations (Brueggemeier et al. 2001, Moobery 2003). We treated MCF-7 cells with E₂, 16-OHE₁, 2-ME₂ or ICI 182,780 as single agents, or E₂ or 16-OHE₁ in combination with 2-ME₂ or ICI 182,780 for 24 and 48 h. There was a significant increase in DNA synthesis by E₂ and 16-OHE₁ (Fig. 2). Our results also showed that E₂-induced DNA synthesis was reduced from 500% to 200% at 24 h and from 400% to 200% at 48 h by 10 nM 2-ME₂. Similarly, 16 -OHE₁-induced DNA synthesis was reduced from 650% to 270% at 24 h and from 500% to 250% at 48 h by 10 nM 2-ME₂. The inhibitory effect of 2-ME₂ was lower than that of the pure antiestrogen, ICI 182,780, which reduced E₂-induced DNA synthesis from 500% to 160% at 24 h and from 400% to 100% at 48 h. These results indicate that 2-ME₂ can interfere with the growth-stimulatory effects of E₂ and 16-OHE₁ in MCF-7 cells.

View larger version (30K): [in this window] [in a new window]   Figure 2 Effects of E2, 16-OHE1 or 2-ME2 on DNA synthesis of MCF-7 breast cancer cells. Cells (0.5x106/dish) were treated with the indicated concentration of E2, 16-OHE1 or 2-ME2 for 24 and 48 h. Results shown are the mean± S.E. from three separate experiments, and the P values were determined by ANOVA followed by Dunnet’s or Tukey’s post-test. *Significant stimulation compared with untreated control, P<0.0001; #significant inhibition compared with untreated control, P<0.01; &significant inhibition compared with E2 or 16 -OHE1-treated cells, P<0.001; $ significant inhibition compared with E2- or 16-OHE1-treated cells, P<0.0001. Fold induction was calculated by dividing the c.p.m. of treated cells by that of untreated control (average c.p.m. for control cells was 52,476±3007; n=3).

Effects of E₂, 16-OHE₁ and 2-ME₂ on cyclin D1 protein and cyclin D1 transactivation

To investigate the mechanism by which 2-ME₂ inhibited E₂- and 16-OHE₁-induced G₁ to S phase progression of MCF-7 cells, we tested its effect on cyclin D1 protein levels. Cells were treated with E₂, 16-OHE₁ 2-ME₂ or ICI 182,780 for 7 h, and the cell lysate was analyzed by Western blotting. The 7-h time point was selected from our previous study showing the maximal induction of cyclin D1 by E₂ and 16-OHE₁ at 6–8 h (Lewis et al. 2001). There was a fourfold increase in cyclin D1 protein level by both E₂ and 16-OHE₁at the 7-h time point, compared with control (Fig. 3A). In contrast, there was no significant change in cyclin D1 protein level in cells treated with 4, 10 or 100 nM 2-ME₂ compared with the control group. However, 2-ME₂ was able to prevent the increase in cyclin D1 protein expression in the presence of E₂ and 16-OHE₁ (Fig. 3B). This effect was comparable to that produced by the pure antiestrogen, ICI 182,780 (Fig. 3B). Thus, a possible mechanism for the ability of 2-ME₂ to retard cell-cycle progression mediated by E₂ and 16-OHE₁ might involve the suppression of cyclin D1.

View larger version (46K): [in this window] [in a new window]   Figure 3 Western blot analysis of cyclin D1 in MCF-7 cells after treatment with E2, 16-OHE1 or 2-ME2. Cells were treated with 10 nM E2 or 16-OHE1, or 4, 10 and 100 nM 2-ME2 for 7 h (A). The effect of E2 and 16-OHE1 on cyclin D1 expression in the presence of 2-ME2 or ICI 182,780 is also shown (B). To verify equal protein loading and transfer, membranes were stripped and reprobed with anti-ß-actin antibody. Results shown represent three separate experiments with comparable results.

View larger version (39K): [in this window] [in a new window]   Figure 4 Effects of E2, 16-OHE1 or 2-ME2 on cyclin D1 promoter activity. MCF-7 cells (1x105 cells/dish) were cotransfected with a full-length cyclin D1 promoter plasmid (–1745CD1-LUC) and Renilla luciferase control plasmid. After 24 h, cells were treated with 10 nM E2, 16-OHE1 or 2-ME2, as single agents, or E2 and 16-OHE1 in the presence of 10 nM 2-ME2 or 100 nM ICI 182,780 for 7 h, and luciferase activity was measured. *Significantly different from untreated control cells at P<0.0001; #significantly different from E2/16-treated cells at P<0.01; &significantly different from E2/16-treated cells at P<0.001. (B) Effect of ATF/CRE mutation on the activation of the full-length cyclin D1 promoter by E2 and 16-OHE1. These experiments were carried out essentially as described in (A), except that cells were transfected with a mutant cyclin D1 plasmid, –1745 CRE/ATFmut-LUC. Results are shown as the mean±S.E. of three separate transfection experiments.

To test the importance of the distal region of the cyclin D1 promoter in its transcriptional activation by E₂ and 16-OHE₁, we used a cyclin D1 promoter plasmid lacking regions –1745 to –964 (–963CD1 LUC). Our results (Fig. 5, upper panel, compared with Fig. 4A) showed that the removal of the distal region did not have a significant effect on cyclin D1 transcriptional activation by E₂ or 16-OHE₁. Furthermore, mutation of the AP-1 site had no marked effect on the induction of cyclin D1 by E₂ or 16-OHE₁ (Fig. 5, lower panel).

View larger version (40K): [in this window] [in a new window]   Figure 5 Transcriptional activation of the cyclin D1 promoter lacking the distal region. Cells were transfected with cyclin D1 promoter plasmid lacking regions –1745 to –964 (–964CD1-LUC) (upper panel) or a plasmid (–964AP1CD1-LUC) with mutation at the AP1 site (lower panel) and the control Renilla luciferase plasmid. Subsequently, cells were treated with E2 or 16-OHE1 in the absence or presence of 2-ME2 or ICI 182,780 for 7 h. *Significantly different from untreated control cells at P<0.0001; #significantly different from E2/16-treated cells at P<0.01; &significantly different from E2/16-treated cells at P<0.001. The results are shown as the mean±S.E. of three separate transfection experiments.

View larger version (29K): [in this window] [in a new window]   Figure 6 Transcriptional activation of the truncated cyclin D1 promoter by E2 and 16-OHE1. (A) Cells (1x105 per dish) were cotransfected with the cyclin D1 promoter (–66CD1 Luc) and Renilla luciferase control plasmid. Cells were treated with E2 or 16-OHE1 in the absence or presence of 2-ME2 or ICI 182,780 for 7 h. (B) Truncated cyclin D1 promoter with ATF/CRE mutation was used for transfection. (C) Truncated cyclin promoter with NF-B site mutation was used for transfection. *Significantly different from untreated control cells at P<0.0001; #significantly different from E2/16-treated cells at P<0.01; &significantly different from E2/16-treated cells at P<0.001. The results are shown as the mean±S.E. of three separate transfection experiments.

Effects of E₂, 16-OHE₁ and 2-ME₂ on ATF-2 binding to CRE/ATF element

In this series of experiments, we examined the effects of E₂, 16-OHE₁ and 2-ME₂ on the binding of ATF-2 to a 74-mer ODN1 from cyclin D1 promoter. Cells were treated with 10 nM E₂, 16-OHE₁ or 2-ME₂, as single agents, or E₂ and 2-ME₂ combinations for 7 h. A cellular extract was prepared, and binding to ODN1 determined by DNA affinity assay. (The specificity of the assay was verified with a mutant 74-mer ODN with a 3 base pair mutation at the ATF-2 binding site.) Figure 7 shows our results from DNA affinity assay with the wild-type 74-mer ODN. There was very little constitutive binding of ATF-2 to ODN1 in the absence of treatment. Treatment of cells with E₂ resulted in a two-to threefold increase (n=3) in ATF-2 binding to ODN1, while 16-OHE₁ caused a fourfold increase (n=3) (Fig. 7). In contrast, treatment of cells with 2-ME₂ resulted in a relatively minor band of ATF-2 binding. Importantly, 2-ME₂ blocked the effects of both E₂ and 16-OHE₁ treatment on ATF-2 binding to ODN1 (Fig. 7A). This inhibitory effect was similar to that observed with ICI 182,780 (Fig. 7B). To verify that the increase in ATF-2 binding was due to phosphorylation, membrane (Fig. 7A) was stripped and reblotted with a phospho-ATF-2 specific antibody. The binding of phosphorylated ATF-2 to ODN1 was increased by 2.5-fold in the presence of E₂ and by fourfold in the presence of 16-OHE₁, compared with control cells. In the presence of 2-ME₂, the effects of E₂ and 16-OHE₁ were significantly reduced (Fig. 7C). These results show that both E₂ and 16-OHE₁ enhanced the DNA- binding activity of ATF-2 through its phosphorylation, and that 2-ME₂ downregulated this process.

View larger version (39K): [in this window] [in a new window]   Figure 7 ATF-2 binding to the CRE/ATF site of cyclin D1 in the presence of E2, 16-OHE1, 2-ME2 or ICI 182,780. MCF-7 cells (2.5x106 cells/dish) were treated with 10 nM E2, 16-OHE1 and 2-ME2 for 7 h. Cellular extracts were incubated with ODN1 for 1 h at 4 °C. The DNA-bound proteins were separated on a 10% SDS-PAGE and identified by immunoblotting with antibodies specific for ATF-2 and phosphorylated ATF-2 (phospho-ATF-2). (A) Effect of 2-ME2 on E2 and 16-OHE1-mediated increase in ATF-2 binding to cyclin D1 promoter. (B) Effect of ICI 182,270 on E2 and 16-OHE1-mediated increase in ATF-2 binding to cyclin D1 promoter. (C) Effect of 2-ME2 on E2 and 16-OHE1-mediated increase in phospho-ATF-2 binding to cyclin D1 promoter. The results presented here represent three separate experiments.

View larger version (63K): [in this window] [in a new window]   Figure 8 Binding of ATF-1, CREB, AP-1 and NF-B proteins to the cyclin D1 CRE/ATF site. MCF-7 cells (2.5x106 cells/dish) were treated with E2, 16-OHE1 or 2-ME2 for 7 h, and cellular extract was incubated with ODN1 (1 µM) for 1 h at 4 °C. The DNA-bound proteins were separated on a 10% SDS-polyacrylamide gel and identified by immunoblotting with antibodies specific for ATF-1, CREB, c-Jun, c-Fos, p50 and p65. The results shown represent three separate binding experiments.

We next performed transfection studies using an ATF-2 dominant negative mutant to verify the importance of ATF-2 protein in cyclin D1 activation. Cells were transfected with the full-length cyclin D1 reporter plasmid along with dominant negative mutant expression vector. After transfection, cells were treated with 10 nM E₂ or 16-OHE₁ in the presence or absence of 2-ME₂ for 7 h, and cyclin D1 luciferase activity was measured. Our results (Fig. 9) showed that transfection of cells with the ATF-2 dominant negative mutant resulted in a significant reduction (four- to sixfold) of E₂-and 16-OHE₁-induced cyclin D1 transactivation. ATF-2 dominant negative mutant in the presence of 2-ME₂ further suppressed cyclin D1 promoter activity. In contrast, overexpression of the ATF-2 wild-type protein partially reversed the inhibitory effects of 2-ME₂ on cyclin D1 transactivation, confirming the importance of ATF-2 in the action of 2-ME₂.

View larger version (42K): [in this window] [in a new window]   Figure 9 Effect of ATF-2 dominant negative mutant (dom neg mut) on E2 and 16-OHE1-stimulated cyclin D1 transactivation. MCF-7 cells were cotransfected with the full-length cyclin D1 luciferase reporter plasmid (–1745CD1-LUC), 10 µg expression vector for ATF-2 dominant negative mutant or ATF-2 wild-type, and Renilla luciferase control. Cells were treated with 10 nM E2, 16-OHE1 or 2-ME2 as separate agents or in combination for 7 h, and luciferase activity was determined. The results shown are the mean±S.E. of three separate experiments. *Significant (P<0.0001) induction compared with untreated control; **significant inhibition compared with E2/16 treatment groups (P<0.001); #significantly different from E2/16-OHE1 and ATF-2 (dom neg mut) treated cells (P<0.05); &significantly different from E2/16-treated cells (P<0.01).

ATF-2 is activated by phosphorylation, in part, by p38 MAPK (Waas et al. 2001, Recio et al. 2002). We therefore examined phosphorylation of p38 MAPK in MCF-7 cells. Cells were treated with 10 nM E₂ or 16-OHE₁, in the presence or absence of 10 nM 2-ME₂ or 100 nM ICI 182,780, and p38 MAPK was detected by Western blotting. Our results (Fig. 10) show that E₂ or 16-OHE₁ caused a threefold increase in the level of phospho-p38 MAPK as compared with the control. In contrast, 2-ME₂ when combined with E₂ or 16-OHE₁, significantly reduced the level of phospho-p38 MAPK. ICI 182,780 also significantly reduced the effect of E₂ and 16-OHE₁ on phospho-p38 levels (Fig. 10). These results indicate that E₂ and its metabolites altered p38 MAPK activity, and suggest a mechanism for the activation of ATF-2.

View larger version (19K): [in this window] [in a new window]   Figure 10 Effects of E2 , 16-OHE1 and 2-ME2 on p38 MAP kinase activity in MCF-7 breast cancer cells. MCF-7 cells (2.5x106 cells/dish) were treated with 10 nM E2 or 16-OHE1 in the presence or absence of 10 nM 2-ME2 or 100 nM ICI 182,780 for 7 h. Cells were then lysed, and active p38 MAP kinase (phospho-p38) was detected by immunoblotting. To ensure equal protein loading, the membrane was stripped and reprobed for total p38 MAP kinase. The result presented here represents three separate experiments.

	Discussion

Top Abstract Introduction Materials and methods Results Discussion References

E₂ was shown to upregulate the levels of cyclin D1 at the mRNA and protein levels along with other critical mediators of cell cycle progression (Altucci et al. 1996, 1997, Foster & Wimalasena 1996, Prall et al. 1997, Doisneau-Sixou et al. 2003). Although E₂-induced regulation of cyclin D1 transcription has been established by these and other studies, the molecular mechanism or mechanisms are complex and poorly defined (Planas-Silva et al. 1999, Sabbah et al. 1999, Foster et al. 2001). It is important to note that the cyclin D1 promoter does not contain an ERE element; however, it contains regulatory elements for ATF-2, AP-1, CREB, NF-B, E2F and SP-1, all of which have been shown to regulate its gene expression (Pestell et al. 1999, Sutherland & Musgrove 2004).

We found that the CRE/ATF site, located at position -54 from the transcriptional start site of the cyclin D1 promoter was required for the induction of cyclin D1 by E₂ and 16-OHE₁. Mutation of this site led to a dramatic reduction (60–80%) in the cyclin D1 promoter activity induced by these agents (Figs 4B and 6B). The marked increase in the DNA binding of ATF-2 in the presence of E₂ and 16-OHE₁ and its inhibition by 2-ME₂ support the role of CRE/ATF-2 site. However, there was about a twofold induction of cyclin D1 promoter activity in ATF/CRE mutant constructs in the presence of E₂. The low level of promoter activity in ATF/CREMUT constructs could be attributed to the binding of AP-1 proteins through consensus or AP-1-like elements. Increased binding of c-Jun and c-Fos to the cyclin D1 promoter fragment supports the role of AP-1 proteins in E₂-induced cyclin D1 transactivation. In contrast, the binding of ATF-1, CREB or NF-B proteins to the cyclin D1 promoter fragment did not show any change in the presence of E₂, 16-OHE₁ or 2-ME₂. These results are consistent with previous reports on the roles of the CRE/ATF and AP-1 sites in cyclin D1 gene activation (Brown et al. 1998, Beier et al. 1999, Lee et al. 1999, Liu et al. 2002). However, mutation of the AP-1 site, while retaining the ATF/CRE site, did not affect cyclin D1 promoter activity. The ability of ATF/CREB proteins to form selective heterodimers with AP-1 proteins (Uht et al. 1997, Chinenov & Kerppola 2001), the presence of AP-1-like elements (GACTA versus the consensus AP-1 element TGACTAA) close to the ATF/CRE site and the ability of ER to interact with the Jun protein (Teyssier et al. 2001) might be important factors in the flexibility of the cyclin D1 transcriptional response.

ICI 182,780 could inhibit cyclin D1 promoter activity induced by E₂ and 16-OHE₁, suggesting that activation of cyclin D1 involves the function of the ER. ICI 182,780 is able to inhibit nongenomic action of E₂, such as the activation of the phosphorylation cascade (Wade et al. 2001, Kinoshita & Chen 2003). ICI 182,780 binding of ER provides it with a unique conformational state, interrupting protein–protein associations (Weatherman et al. 2002, Margeat et al. 2003). In addition, ligand-induced alterations in signaling pathways determine the availability and homo/heterodimer formation between ATF-2, c-Jun and c-Fos, leading to their binding to the CRE/ATF motif of the cyclin D1 promoter. The formation of these multiprotein complexes and their DNA binding appears to be facilitated by the presence of E₂ and 16-OHE₁, but disrupted by 2-ME₂ and ICI 182,780.

While the ability of 2-ME₂ to inhibit E₂-induced growth stimulation suggests that it might be functioning like an antiestrogen, 2-ME₂ does not have the properties of ICI 182,780 or other antiestrogens. 2-ME₂ has very low binding affinity for ER (~1% that of E₂) (Dubey et al. 2000, Brueggemeier et al. 2001) and inhibits both ER-positive and ER-negative tumor growth (Robertson 2001, Schumacher & Neuhaus 2001). However, binding affinity does not always correlate with biologic activity. Previous studies have indicated that 16-OHE₁ binds to the classical ER with an affinity ~10% of that of E₂; however, it is as potent as E₂ in stimulating uterine growth (Suto et al. 1999). 16-OHE₁ was slightly more potent than E₂ in stimulating DNA synthesis, cell cycle progression and cyclin D1 expression in MCF-7 cells (Lewis et al. 2001). Hence, the antiestrogenic effects of 2-ME₂ might not be dependent on its high affinity binding to the classical ER. Alternatively, as suggested by Kousteini et al.(2001), the classical binding assays may not capture the efficiency of ligand association rates, but rather the ratio of association to dissociation rates.

It is also possible that 2-ME₂ may utilize a receptor that is distinct from the classical ER. Potential receptors include: 1. the type II ER (Markaverich & Clark 1987, Shoulars et al. 2002); 2. one or more of the variants of ER or ERß (Fuqua et al. 1991) and 3. certain members of the nuclear orphan receptor family (Laudet et al. 1992). Plasma membrane ER that mediates rapid activation of signaling pathways in response to E₂ is found in target cells (Migliaccio et al. 1996, Falkenstein et al. 2000, Kousteni et al. 2001). Although plasma membrane ER is reported to be similar to the classical nuclear ER, unique ligand specificity might exist due to ER association with scaffold proteins, such as caveolin (Razandi et al. 1999, Marquez & Pietras 2001, Song et al. 2004). Therefore, E₂ and 16-OHE₁ can utilize a number of signaling pathways other than the classical ER pathway to stimulate the transcription of cyclin D1. The mechanism of 2-ME₂ in antagonizing the effects of E₂ appears to involve a blockade of estrogenic signaling through p38 MAPK and ATF-2 phosphorylation.

ATF-2 is phosphorylated by JNK/SAPK and p38 MAP kinases, in response to cellular stress (van Dam et al. 1995, Raingeaud et al. 1996), and by extracellular signal-regulated kinases (ERK), in response to growth factors (Albanese et al. 1995,Watanabe et al. 1996). Phosphorylation of ATF-2 increases its transcriptional activity by relieving intramolecular inhibitory interaction between the DNA-binding domain and the transactivating domain (Abdel-Hafiz et al. 1992, Kawasaki et al. 2000). In our experiments, increased ATF-2 binding to DNA was facilitated by ATF-2 phosphorylation and associated cyclin D1 transcriptional activation. Activation of p38 MAPK appears to be responsible for ATF-2 phosphorylation, since a three- to fourfold higher level of phosphorylated p38 MAPK is found in cells treated with E₂ and 16-OHE₁ than in control cells. 2-ME₂ blocked the stimulatory effects of E₂ and 16-OHE₁ on ATF-2 phosphorylation and cyclin D1 promoter activation. The inhibitory effect of 2-ME₂ might be due to reduced phosphorylation of p38 MAPK. However, it is not known what step of the signaling cascade, leading to the phosphorylation of p38 MAPK, is inhibited by 2-ME₂.

Activation of p38 MAPK might be mediated by nongenomic action of estrogens. Recent studies reveal many instances of estrogenic action with activation of Src/Shc/ERK signaling pathways by ER located on membrane sites of target cells (Castoria et al. 2001, Kousteni et al. 2001, Song et al. 2002, 2004). Estrogenic action may include ER interaction with the G protein-coupled receptor, GPCR30, which stimulates adenylyl cyclase activity, leading to the production of cAMP and associated signaling (Aronica et al. 1994, Filardo et al. 2002). Alternatively, E₂ stimulation of MCF-7 cells may induce a direct interaction between ER, Src and the p85 subunit of phosphatidylinositol (PI)3-kinase, thereby activating the PI3K/Akt pathway (Migliaccio et al. 1996). In another study, the HER-2 signaling pathway was implicated in E₂-induced activation of Akt (Stoica et al. 2003). Akt may activate p38 MAPK (Madrid et al. 2001). Further studies are needed to validate the involvement of these pathways in the activation of p38 MAPK by E₂.

Previous studies indicated that 2-ME₂ inhibits DNA synthesis in MCF-7 and MDA-MB-231 breast cancer cells (Seegers et al. 1989, Brueggemeier et al. 2001, Schumacher & Neuhaus 2001). In human prostate cancer, 2-ME₂ inhibited tumor growth by arresting cells in the G₂/M phase of the cell cycle (Kumar et al. 2001). The 2-ME₂-induced G₂/M block, occurring at 3 µM concentration, was associated with a significant increase in p21 and cdc2 expression. An effect of 2-ME₂ on tubulin polymerization has been reported at 3 µM or higher concentration (Cushman et al. 1995, Klauber et al. 1997, Pribluda et al. 2000). In the osteosarcoma 143 B cell line, a dual effect of 2-ME₂ on cell cycle was observed with G₁ arrest at 1 µM level and G₂/M arrest at 10 µM level (Golebiewska et al. 2002). We found that 2-ME₂ is effective in blocking the stimulatory effects of E₂ and 16-OHE₁ on DNA synthesis, and G₁ to S phase progression. The increased expression of cyclin D1 caused by E₂ and 16-OHE₁ is downregulated by 2-ME₂. In the absence of E₂, the low level of DNA synthesis found in phenol red-free cells is inhibited by 2-ME₂, although this was not sufficient to be detected as a cell cycle arrest by flow cytometry. Thus, in the absence of E₂, MCF-7 cells remain largely (77–82%) in the G₁ phase in the presence or absence of low concentrations of 2-ME₂. This may be because breast cancer cells with low growth fraction are more resistant to the action of antiproliferative agents than log-phase cells (Carlisle et al. 2002).

In summary, our results show that E₂ and 16-OHE₁ stimulate cell growth and cell cycle progression by upregulating cyclin D1 expression, whereas 2-ME₂, like an antiestrogen, blocks the stimulatory effects of E₂ and 16-OHE₁. Estrogenic regulation of the cyclin D1 gene occurs at the transcriptional level and is mediated by the CRE/ATF-2 element, located at -54 upstream of the cyclin D1 promoter transcription start site. Transcriptional activation of cyclin D1 by E₂ and 16-OHE₁ is dependent on phosphorylation and binding of ATF-2 to the CRE/ATF motif. Our results demonstrate an antiestrogenic effect of 2-ME₂ in MCF-7 breast cancer cells, and suggest that cyclin D1 might be a key target in the growth-inhibitory actions of 2-ME₂. Our results also indicate that transduction of the estrogenic signal for cell proliferation includes phosphorylation cascades involving the activation of p38 MAP kinase.

	Acknowledgements

 
This work was supported by National Institutes of Health grants CA42439, CA42439S1, CA73058, CA73058S1, CA80163 (to T T & T J T), ES05022 (to M A G), CA75503, CA70896, CA86072, CA93596 (to R G P) and AG20337 (to C A), and grants from the UMDNJ Foundation (to T T) and the Susan G Komen Breast Cancer Foundation (to R G P and T T). R G P is a recipient of the Weil Caulier Irma T Hirschl Career Scientist award.

	References

Top Abstract Introduction Materials and methods Results Discussion References

 
Abdel-Hafiz HA, Heasley LE, Kyriakis JM, Avruch J, Kroll DJ, Johnson GL & Hoeffler JP 1992 Activating transcription factor-2 DNA-binding activity is stimulated by phosphorylation catalyzed by p42 and p54 microtubule-associated protein kinases. Molecular Endocrinology 6 2079–2089.[Abstract]

Albanese C, Johnson J, Watanabe G, Eklund N, Vu D, Arnold A & Pestell RG 1995 Transforming p21 ras mutants and c-Ets-2 activate the cyclin D1 promoter through distinguishable regions. Journal of Biological Chemistry 270 23589–23597.[Abstract/Free Full Text]

Altucci L, Addeo R, Cicatiello L, Dauvois S, Parker MG, Truss M, Beato M, Sica V, Bresciani F & Weisz A 1996 17ß-Estradiol induces cyclin D1 gene transcription, p36D1-p34 cdk4 complex activation and p105Rb phosphorylation during mitogenic stimulation of G(1)-arrested human breast cancer cells. Oncogene 12 2315–2324.[ISI][Medline]

Altucci L, Addeo R, Cicatiello L, Germano D, Pacilio C, Battista T, Cancemi M, Petrizzi VB, Bresciani F & Weisz A 1997 Estrogen induces early and timed activation of cyclin-dependent kinases 4, 5, and 6 and increases cyclin messenger ribonucleic acid expression in rat uterus. Endocrinology 138 978–984.[Abstract/Free Full Text]

Aronica SM, Kraus WL & Katzenellenbogen BS 1994 Estrogen action via the cAMP signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene transcription. PNAS 91 8517–8521.[Abstract/Free Full Text]

Ball P, Knuppen R, Haupt M & Breuer H 1972 Interactions between estrogens and catechol amines. III. Studies on the methylationof catechol estrogens, catechol amines and other catechols by the catechol O-methyltransferase of human liver. Journal of Clinical Enodcrinology and Metabolism 34 736–746.

Beier F, Lee RJ, Taylor AC, Pestell RG & LuValle P 1999 Identification of the cyclin D1 gene as a target of activating transcription factor 2 in chondrocytes. PNAS 96 1433–1438.[Abstract/Free Full Text]

Berthois Y, Katzenellenbogen JA & Katzenellenbogen BS 1986 Phenol red in tissue culture media is a weak estrogen: implications concerning the study of estrogen responsive cells in culture. PNAS 83 2496–2500.[Abstract/Free Full Text]

Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C & Darnell JE Jr 1999 Stat3 as an oncogene. Cell 98 295–303.[CrossRef][ISI][Medline]

Brown JR, Nigh E, Lee RJ, Ye, H, Thompson MA, Saudou F, Pestell RG & Greenberg ME 1998 Fos family members induce cell cycle entry by activitating cyclin D1. Molecular and Cellular Biology 18 5609–5619.[Abstract/Free Full Text]

Brueggemeier RW, Bhat AS, Lovely CJ, Coughenour HD, Joomprabutra S, Weitzel DH, Vandre DD, Yusuf F & Burak WE Jr 2001 2-Methoxymethylestradiol: a new 2-methoxy estrogen analog that exhibits antiproliferative activity and alters tubulin dynamics. Journal of Steroid Biochemistry and Molecular Biology 78 145–156.[CrossRef][ISI][Medline]

Carlisle DL, Devereux WL, Hacker A, Woster PM & Casero RA Jr 2002 Growth status significantly affects the response of human lung cancer cells to antitumor polyamine-analogue exposure. Clinical Cancer Research 8 2684–2689.[Abstract/Free Full Text]

Castoria G, Migliaccio A, Bilancio A, Di Domenico M, de Falco A, Lombardi M, Fiorentino R, Varricchio L, Barone MV & Auricchio F 2001 PI3-kinase in concert with Src promotes the S-phase entry of oestradiol-stimulated MCF-7 cells. EMBO Journal 20 6050–6059.[CrossRef][ISI][Medline]

Chinenov Y & Kerppola T 2001 Close encounters of many kinds: Fos-Jun interactions that mediate transcription regulatory specificity. Oncogene 20 2438–2452[CrossRef][ISI][Medline]

Cushman M, He HM, Katzenellenbogen JA, Lin CM & Hamel E 1995 Synthesis, antitubulin and antimitotic activity, and cytotoxicity of analogs of 2-methoxyestradiol, an endogenous mammalian metabolite of estradiol that inhibits tubulin polymerization by binding to the colchicine binding site. Journal of Medical Chemistry 38 2041–2049.

D’Amato RJ, Lin CM, Flynn E, Folkman J & Hamel E 1994 2-Methoxyestradiol, an endogenous mammalian metabolite, inhibits tubulin polymerization by interacting at the colchicine site. PNAS 91 3964–3968.[Abstract/Free Full Text]

D’Amico M, Hulit J, Amanatullah DF, Zafonte BT, Albanese C, Bouzahzah B, Fu M, Augenlicht LH, Donehower LA, Takemaru K, Moon RT, Davis R, Lisanti MP, Shtutman M, Zhurinsky J, Ben-Ze’ev A, Troussard AA, Dedhar S & Pestell RG 2000 The integrin-linked kinase regulates the cyclin D1 gene through glycogen synthase kinase 3 beta and cAMP-responsive element-binding protein-dependent pathways. Journal of Biological Chemistry 275 32649–32657.[Abstract/Free Full Text]

Doisneau-Sixou SF, Sergio CM, Carroll JS, Hui R, Musgrove EA & Sutherland RL 2003 Estrogen and antiestrogen regulation of cell cycle progression in breast cancer cells. Endocrine-Related Cancer 10 179–186.[Abstract]

Dubey RK, Gillespie DG, Zacharia LC, Rosselli M, Korzekwa KR, Fingerle J & Jackson EK 2000 Methoxyestradiols mediate the antimitogenic effects of estradiol on vascular smooth muscle cells via estrogen receptor-independent mechanisms. Biochemical and Biophysical Research Communications 278 27–33.[CrossRef][ISI][Medline]

Falkenstein E, Tillmann HC, Christ M, Feuring M & Wehling M 2000 Multiple actions of steroid hormones – a focus on rapid, nongenomic effects. Pharmacological Reviews 52 513–556.[Abstract/Free Full Text]

Filardo EJ, Quinn JA, Frackelton AR Jr & Bland KI 2002 Estrogen action via the G protein-coupled receptor, GPR30: stimulation of adenylyl cyclase and cAMP-mediated attenuation of the epidermal growth factor receptor-to-MAPK signaling axis. Molecular Endocrinology 16 7084.

Fishman J & Martucci CP 1980 Biological properties of 16 alpha-hydroxyesterone: implications of estrogen physiology and pathophysiology. Journal of Clinical Endocrinology and Metabolism 51 611–615.[Abstract]

Foster JS & Wimalasena J 1996 Estrogen regulates activity of cyclin-dependent kinases and retinoblastoma protein phosphorylation in breast cancer cells. Molecular Endocrinology 10 488–498.[Abstract]

Foster JS, Henley DC, Ahamed S & Wimalasena J 2001 Estrogens and cell-cycle regulation in breast cancer. Trends in Endocrinology and Metabolism 12 320–327.[CrossRef][ISI][Medline]

Fotsis T, Zhang Y, Pepper MS, Adlercreutz H, Montesanno R, Nawroth PP & Schwelgerer L 1994 The endogenous oestrogen metabolite 2-methoxyestradiol inhibits angiogenesis and suppresses tumor growth. Nature 368 237–239.[CrossRef][Medline]

Fuqua A, Fitzgerald SD, Chamness GC, Tandon AK, McDonnell DP, Nawaz Z, O’Malley BW & McGuire WL 1991 Variant human breast tumor estrogen receptor with constitutive transcriptional activity. Cancer Research 51 105–109.[Abstract/Free Full Text]

Golebiewska J, Rozwadowski P, Spodnik JH, Knap N, Wakabayashi T & Wozniak M 2002 Dual effect of 2-methoxyestradiol on cell cycle events in human osteosarcoma 143B cells. Acta Biochimica Polonica 49 59–65.[ISI][Medline]

Gupta S, Campbell D, Derijard B & Davis RJ 1995 Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267 389–393.[Abstract/Free Full Text]

Gupta M, McDougal A & Safe S 1998 Estrogenic and antiestrogenic activities of 16- and 2-hydroxy metabolites of 17ß-estradiol in MCF-7 and T47D human breast cancer cells. Journal of Steroid Biochemistry and Molecular Biology 67 413–419.[CrossRef][ISI][Medline]

Guttridge DC, Albanese C, Reuther JY, Pestell RG & Baldwin AS 1999 NF-ßB controls cell growth and differentiation through transcriptional regulation of cyclin D1. Molecular Cell Biology 19 5785–5799.[Abstract/Free Full Text]

Hai TW, Liu F, Coukos WJ & Green MR 1993 Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes and Development 3 2083–2090.

Henderson BE, Ross R & Berstein L 1988 Estrogens as a cause of human cancer: the Richard and Hinda Rosenthal Foundation award lecture. Cancer Research 48 246–253.[Free Full Text]

Herber B, Truss M, Beato M & Muller R 1994 Inducible regulatory elements in the human cyclin D1 promoter. Oncogene 9 1295–1304.[ISI][Medline]

Jefcoate CR, Liehr JG, Santen RJ, Sutter TR, Yager JD, Yue W, Santner SJ, Tekmal R, Demers L, Pauley R, Naftolin F, Mor G & Berstein L 2000 Tissue-specific synthesis and oxidative metabolism of estrogens. Journal of the National Cancer Institute Monographs 27 95–112.

Katazenellenbogen BS, Montano MM, Ediger TR, Sun J, Ekena K, Laz Martini PG, McInerney EM, Delage-Mourrous R, Weis K & Katzenellenbogen JA 2000 Estrogen receptors: selective ligands, partners, and distinctive pharmacology. Recent Progress in Hormone Research 55 163–193.

Kawasaki H, Taira K & Yokoyama K 2000 Histone acetyltransferase (HAT) activity of ATF-2 is necessary for the CRE-dependent transcription. Nucleic Acids Symposium Series 44 259–260.[Abstract/Free Full Text]

Kinoshita Y & Chen S 2003 Induction of aromatase (CYP19) expression in breast cancer cells through a nongenomic action of estrogen receptor alpha. Cancer Research 63 3546–3555.[Abstract/Free Full Text]

Klauber N, Parangi S, Flynn E, Hamel E & D’Amato RJ 1997 Inhibition of angiogenesis and breast cancer in mice by the microtubule inhibitors 2-methoxyestradiol and taxol. Cancer Research 57 81–86.[Abstract/Free Full Text]

Kousteni S, Bellido T, Plotkin LI, O’Brien CA, Bodenner DL, Han L, Han K, DiGregorio B, Katzenellenbogen JA, Katzenellenbogen BS, Roberson PK, Weinstein RS, Jilka R &am