|
|
||||||||
-hydroxyestrone and 2-methoxyestradiol on cyclin D1 involving the transcription factor ATF-2 in MCF-7 breast cancer cells
1 Department of Medicine and
2 Department of Environmental and Occupational Medicine, University of Medicine and Dentistry of New Jersey Robert Wood Johnson Medical School, New Brunswick, NJ 08903, USA
3 Environmental and Occupational Health Sciences Institute and
4 Department of Oncology, Lombardi Cancer Center, Georgetown University, Washington DC 20057, USA
5 The Cancer Institute of New Jersey, New Brunswick, New Jersey 08903, USA
(Requests for offprints should be addressed to T Thomas, Clinical Academic Building, Room 7092, UMDNJ Robert Wood Johnson Medical School, 125 Paterson Street, New Brunswick, New Jersey 08903, USA; Email: thomasth{at}UMDNJ.edu)
| Abstract |
|---|
|
|
|---|
-hydroxyestrone (16
-OHE1), two metabolites of estradiol (E2), on DNA synthesis, cell cycle progression and cyclin D1 protein levels in estrogen receptor-positive MCF-7 cells. E2 and 16
-OHE1 stimulated DNA synthesis, and 2-ME2 inhibited the stimulatory effects of these agents. E2 and 16
-OHE1 stimulated the progression of cells from G1 to S phase and this effect was attenuated by 2-ME2. Western blot analysis showed that E2 and 16
-OHE1 increased cyclin D1 protein level by about fourfold compared with control. 2-ME2 had no significant effect on cyclin D1; however, it prevented the accumulation of cyclin D1 in the presence of E2 and 16
-OHE1. Cells transfected with a cyclin D1 reporter gene and treated with E2 or 16
-OHE1 showed 7- and 9.5-fold increase respectively in promoter activity compared with control. This activity was significantly inhibited by 2-ME2. Cyclin D1 transactivation was mediated by the cAMP response element (CRE) region, which binds activating transcription factor 2 (ATF-2). DNA affinity assay showed 2.5- and 3.5-fold increases in ATF-2 binding to CRE in the presence of E2 and 16
-OHE1 respectively. The binding of ATF-2 was inhibited by the presence of 2-ME2. These results show that 2-ME2 can downregulate cyclin D1 and thereby cell cycle progression by a mechanism involving the disruption of ATF-2 binding to cyclin D1 promoter.
| Introduction |
|---|
|
|
|---|
and ERß), ligand-activated transcription factors present in target tissues (Katzenellenbogen et al. 2000, McKenna & OMalley 2002, Thomas et al. 2004). In general, estrogenic action involves the binding of the ligand to the ER, which undergoes conformational changes and dimerization, and is recognized by the estrogen response element (ERE), located at the promoter region of estrogen-responsive genes. The ERERE interaction triggers a cascade of cellular events, leading to the transcriptional activation of specific genes responsible for cell proliferation (Nilsson & Gustafsson 2002).
E2 is metabolized by oxidation and hydroxylation (Martucci & Fishman 1993, Zhu & Conney 1998). The oxidation product of E2 is estrone (E1), which is metabolized by two mutually exclusive hydroxylation pathways: hydroxylation at the C-2 or the 16
position (Fig. 1
). Hydroxylation at the C-2 position yields 2-hydroxyestrone (2-OHE1) and 2-hydroxyestradiol (2-OHE2), whereas hydroxylation at the 16
position yields 16
-hydroxyestrone (16
-OHE1) and 16
- hydroxyestradiol (16
-OHE2). Increased 16
-hydroxylation in women is associated with increased breast cancer risk (Muti et al. 2000). 16
-Hydroxylated metabolites stimulate breast cancer cell growth, whereas the 2-hydroxylated estrogens inhibit cell growth (Ball et al. 1972, Seegers et al. 1989, Lottering et al. 1992, Zhu & Conney 1998). 2-OHE1 and 2-OHE2 are rapidly converted to the monomethyl ethers, 2-ME1 and 2-ME2 respectively by the enzyme catechol-O-methyltransferase (COMT) (Ball et al. 1972, Jefcoate et al. 2000). 2-ME2 inhibits the growth of human mammary cancer cells in vitro and in vivo (Lottering et al. 1992, Fotis et al. 1994). The binding affinity 2-ME2 for ER from MCF-7 cells is about 1% of that of E2 (Brueggemeier et al. 2001). Low concentrations (10 nM) of 2-ME2 inhibit the growth of ER-positive MCF-7 cells, and cause fluctuations in cAMP levels, whereas pharmacologic concentrations (110 µM) inhibit tubulin polymerization and angiogenesis (Lottering et al. 1992, DAmato et al. 1994, Cushman et al. 1995, Klauber et al. 1997, Moobery 2003).
|
-OHE1 stimulates the proliferation of these cells (Gupta et al. 1998, Suto et al. 1999). 16
-OHE1 binds to the ER with measurable affinity and exerts uterotropic activity, comparable to that of E2 (Fishman & Martucci 1980). We found that 16
-OHE1 and E2 had comparable effects on cell cycle kinetics and in stimulating the expression of cyclin D1 in MCF-7 cells (Lewis et al. 2001).
Cyclin D1 is an important regulator of G1
S phase transition, and its expression in breast cancer cells is sensitive to estrogens and antiestrogens (Musgrove et al. 1994, Altucci et al. 1996, Foster & Wimalasena 1996, Pacilio et al. 1998, Pestell et al. 1999). In transgenic mice, overexpression of cyclin D1 led to the development of mammary tumors, while cyclin D1 knockout mice showed impaired development of mammary glands (Wang et al. 1994, Sicinski & Weinberg 1997). The promoter region of cyclin D1 contains binding sites for AP1, SP1, NF-
B and ATF/CREB, all of which are implicated in its transcriptional activation (Herber et al. 1994, Albanese et al. 1995, Watanabe et al. 1998, Bromberg et al. 1999, Guttridge et al. 1999). Recent studies indicate that E2 regulation of cyclin D1 in MCF-7 cells occurs at the transcriptional level, and involves the cAMP response element (CRE) (Altucci et al. 1996, Sabbah et al. 1999). The CRE element binds bZIP DNA-binding proteins belonging to the ATF/CREB family of transcription factors (Hai et al. 1993). ATF-2 is a member of the ATF/CREB family, and stimulates the transcription of cyclin D1 (Beier et al. 1999, Sabbah et al. 1999). The ability of ATF-2 to bind to the CRE and stimulate CRE-mediated transcription is regulated by phosphorylation (Gupta et al. 1995).
In the present study, we examined the effects of E2, 16
-OHE1 and 2-ME2 on DNA synthesis and cell cycle progression, cyclin D1 transactivation and ATF-2 DNA-binding activity in MCF-7 breast cancer cells. Our results showed that 2-ME2 interfered with the growth stimulatory effects of E2 and 16
-OHE1, as did the pure antiestrogen, ICI 182,780. In transient transfection assays, E2 and 16
-OHE1 enhanced cyclin D1 promoter activity, while 2-ME2 and ICI 182,780 inhibited this effect. The estrogenic effect on cyclin D1 was mediated through the binding of ATF-2 to the CRE site.
| Materials and methods |
|---|
|
|
|---|
E2, 16
-OHE1 and 2-ME2 were purchased from Steraloids (Wilton, NH, USA). The pure antiestrogen ICI 182,780 was purchased from Tocris (Ellisville, MO, USA). Monoclonal antihuman ATF-2, phospho-ATF-2, CREB, ATF-1, c-Jun, c-Fos, p65, p50, p38 and phospho-p38 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Mono-clonal anti-cyclin D1 antibody was from LabVision (Fremont, CA, USA). DMEM, phenol red-free DMEM and fetal bovine serum were purchased from Sigma. The HexaPlus DNA labeling kit was obtained from MBI Fermentas (Amherst, NY, USA). Antibiotics, trypsin and other additives for cell culture were purchased from Gibco Laboratories (Grand Island, NY, USA). Dynabeads M-280, Streptavidin and Dynal MPC-S were obtained from Dynal Biotechnology (Lake Success, NY, USA). Biotin-162'-deoxyuridine-5'-triphosphate (Biotin-16-dUTP) was purchased from Sigma.
Oligonucleotides and plasmids
HPLC-purified oligonucleotides (ODNs) were purchased from Oligos, Etc (Wilsonville, OR, USA). A 74-bp ODN1, with cyclin D1 promoter sequence (78 to 5) containing the consensus CRE (underlined) and NF-
B response element (boldface) was used for DNA affinity assays. A mutated CRE/ATF ODN2 with a three-base rearrangement in the consensus sequence (underlined and boldface) was used for determining sequence specificity of the CRE/ATF-2 binding. The base sequence of the top strands of the ODNs used in this study are as follows:
ODN1: 5'-GGGCTTTGATCTTTGCTTAACAAC AGTAACGTCACACGGACTACAGGGGAGTTTTG TTGAAGTTGCAAAGTCCT-3'
ODN2: 5'GGGCTTTGATCTTTGCTTAACAAC AGTAGCGGCACACGGACTACAGGGGAGTTTT GTTGAAGTTGCAAAGTCCT-3'
For transcriptional activation studies, the cyclin D1 luciferase reporter plasmids -1745CD1-LUC, -1745 ATF/CREmut-LUC, -964CD1-LUC, -964AP1 mut-LUC, -66CD1-LUC, -66 ATF/CREmut-LUC and -66CD1
Bmut-LUC were used. These reporter gene constructs have been previously described (Albanese et al. 1995, Watanabe et al. 1999). A mutant and wild-type human ATF-2 cDNA, subcloned into the eukaryotic expression vector pCMV, was used to express ATF-2 dominant negative mutant (ATF-2 dom neg mutant) and wild-type proteins in transfected cells (Lee et al. 1999, DAmico et al. 2000). The pRL-SV40 vector (Promega) containing the Renilla luciferase gene was used as an internal control.
Cell culture methods
MCF-7 cells were obtained from the American Type Culture Collection (Rockville, MD, USA). Cells were maintained in DMEM, supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin, 40 µg/ml genta-micin, 2 µg/ml insulin, 0.5 mM sodium pyruvate, 50 mM nonessential amino acids, 2 mM L-glutamine and 10% fetal bovine serum. Two weeks before each experiment, MCF-7 cells were grown in phenol red-free DMEM containing serum treated with dextran-coated charcoal (DCC) to remove serum-derived estrogenic compounds (Berthois et al. 1986, Thomas et al. 1989, Lewis et al. 2001). DCC suspension contained 0.05% dextran, 0.5% charcoal and 25 mM sucrose. Serum was subjected to three 10-min cycles of DCC treatment, centrifugation and filtering through a 0.2 µm membrane.
For [3H]thymidine incorporation assay, MCF-7 cells (0.5 x 106) were seeded in 35 mm culture dishes in phenol red-free DMEM supplemented with DCC-treated serum and additives. After 24 h of plating, cells were treated with 10 nM E2, 16
-OHE1 or 2-ME2, as indicated in the text. Control cells received ethanol vehicle, which was maintained at less than 0.1%. DNA synthesis was measured by adding 4 µCi/ml [3H]thymidine to cells 1 h before harvest. Cells were washed twice with ice-cold PBS and treated with ice-cold 5% trichloroacetic acid. The cell layer was then solubilized in 1 M NaOH and neutralized with 1 M HCl. The radioactive thymidine incorporated in cellular DNA was quantified by liquid scintillation counting.
For cell cycle analysis, MCF-7 cells (2x106) were seeded in 100 mm culture dishes for 24 h and then treated with E2, 16
-OHE1, 2-ME2 or ICI 182,780 for 24 and 48 h. Triplicate plates from each treatment group were washed with PBS and covered with a buffer containing 40 mM sodium citrate, 250 mM sucrose and 5% DMSO, and stored at 70 °C. On the day of DNA analysis, cells were thawed, and the citrate buffer was removed. Cells were trypsinized for 10 min and then treated with a solution containing a trypsin inhibitor and RNase for 10 min. Cells were then stained by adding propidium iodide solution in sodium citrate buffer and analyzed by a Coulter flow cytometer. Percentage distribution of cells in different phases of cell cycle was calculated with cytologic software (Thomas & Thomas 1994).
Western blot analysis
Cyclin D1 protein levels in MCF-7 cells were determined by Western blot, after treatment with E2, 16
-OHE1, 2-ME2 or ICI 182,780. Cell lysate was prepared by the procedure previously described (Thomas & Thomas 1994). Briefly, monolayers of cells were washed twice with ice-cold PBS, and lysed by the addition of ice-cold lysis buffer (150 mM TrisHCl (pH 7.4), 150 mM NaCl, 1% NP-40, 2 mM EDTA, 50 mM sodium fluoride, 0.2% SDS, 1 mM sodium vanadate, 2 µg/ml leupeptin, aprotonin and pepstatin, and 1 mM phenylmethylsulfonyl fluoride). An amount of 30 µg protein was diluted in 2xSDSPAGE Laemmli buffer (150 mM Tris base (pH 6.8), 30% glycerol, 4% SDS, 7.5 mM dithiothreitol and 0.01% bromophenol blue) and separated on 10% SDS-polyacrylamide gel. Proteins were transferred to PVDF Polyscreen membranes, which were incubated in 5% nonfat milk in Trisbuffered saline, containing 0.1% Tween-20 for 1 h. Membranes were then incubated overnight with a 1:200 dilution of antibodies specific to human cyclin D1, phospho-p38 MAPK (activated) or p38 MAPK (total) respectively. Protein bands were visualized with horse-radish peroxidase-conjugated secondary antibody with a chemiluminescence-based detection system. Membranes were stripped and reblotted with anti-ß-actin mono-clonal antibody (1:5000). Intensity of protein bands was quantified with a Scanjet 4C flatbed scanner (Hewlett Packard) with NIH Image v1.52 software. Lightly exposed films were used for quantification.
Transient transfection assay
MCF-7 cells (1x105) were plated in 24-well microtiter plates for 24 h. By the calcium phosphate coprecipitation procedure (Mamalian Transfection Kit; Clontech, Palo Alto, CA, USA), cells were transfected with 4 µg cyclin D1 promoter plasmid linked to a firefly luciferase reporter gene and 0.4 µg Renilla luciferase plasmid (Shah et al. 2001). In some experiments, cells were also transfected with 110 µg ATF-2 dominant negative mutant expression vector (pCMV). After transfection, the medium was refreshed, and cells were treated with 10 nM E2, 16
-OHE1 or 2-ME2, or 100 nM ICI 182,780 for 7 h. The activities of the cyclin D1 firefly reporter gene and the Renilla luciferase internal control were determined in a dual luciferase reporter assay system (Promega). Reporter activity was normalized for each sample by the following formula: normalized luciferase activity=firefly luciferase activity/Renilla luciferase activity.
DNA affinity immunoblot assay
Treatments and preparation of cellular extracts were as described under Western blot analysis.
ODNs were biotinylated with the HexaLabel Plus DNA labeling kit. Biotinylated ODNs (1 µM) were immobilized by incubating with the Dynabeads (1 mg/ml) in TE buffer (10 mM TrisHCl, pH 7.5, 1 mM EDTA, 1 M NaCl) for 15 min at 22 °C. The Dynabeads containing the immobilized biotinylated DNA were washed, separated in Dynal MPC-S and incubated with cellular extract (100 µg) in 8 mM Trisphosphate at pH 7.4, 0.12 M KCl, 8% glycerol, 4 mM DTT and 0.5% CHAPS for 1 h at 4 °C (Zwijsen et al. 1998). Subsequently, beads were washed in 10 mM HEPES at pH 7.7, 50 mM KCl, 20% glycerol and 0.1% NP-40, and boiled in Laemmli buffer (100 µl), and the DNA-bound proteins were separated on 10% polyacrylamide gel. Proteins were identified by immunoblotting with antibodies specific for ATF-2, phospho-ATF-2, ATF-1, c-Fos, c-Jun, CREB or p65. Membranes were stripped and reprobed, using an antibody to a transcription factor (p50), which did not show any change with treatments, as a control for equal loading and transfer.
Statistical analysis
Results of transient transfection studies are presented as mean ± S.E. for at least three separate experiments. Statistical difference between control and treatment groups was determined by one-way ANOVA followed by Dunnets post-test (GraphPad Prism Software program, San Diego, CA, USA). A P value of <0.05 was considered to be statistically significant.
| Results |
|---|
|
|
|---|
-OHE1 and 2-ME2 on DNA synthesis and cell cycle
In the first set of experiments, we tested the effects of 10 nM E2, 16
-OHE1 and 2-ME2 on DNA synthesis in MCF-7 breast cancer cells by the [3H] thymidine incorporation assay. A concentration of 10 nM was used to observe maximal effects of E2 and 16
-OHE1 (Lewis et al. 2001) and to avoid the cytotoxic effects of 2-ME2 observed at µM concentrations (Brueggemeier et al. 2001, Moobery 2003). We treated MCF-7 cells with E2, 16
-OHE1, 2-ME2 or ICI 182,780 as single agents, or E2 or 16
-OHE1 in combination with 2-ME2 or ICI 182,780 for 24 and 48 h. There was a significant increase in DNA synthesis by E2 and 16
-OHE1 (Fig. 2
). Our results also showed that E2-induced DNA synthesis was reduced from 500% to 200% at 24 h and from 400% to 200% at 48 h by 10 nM 2-ME2. Similarly, 16
-OHE1-induced DNA synthesis was reduced from 650% to 270% at 24 h and from 500% to 250% at 48 h by 10 nM 2-ME2. The inhibitory effect of 2-ME2 was lower than that of the pure antiestrogen, ICI 182,780, which reduced E2-induced DNA synthesis from 500% to 160% at 24 h and from 400% to 100% at 48 h. These results indicate that 2-ME2 can interfere with the growth-stimulatory effects of E2 and 16
-OHE1 in MCF-7 cells.
|
-OHE1 and 2-ME2 as single agents or in combination, and the percent distribution of cells in different phases of the cell cycle was determined at 24- and 48-h time points by flow cytometry (Table 1
-OHE1 reduced the numbers of cells in the G1 phase from 77.5% to 66.4% and 65.3% respectively, while increasing the numbers of cells in S phase from 11% to 22.6% and 23.3% respectively. In contrast, treatment of cells with 2-ME2, as a single agent, did not have any significant effect on cell cycle distribution. However, 2-ME2 blocked the stimulatory effects of E2 and 16
-OHE1 on G1 to S phase transition by 48 h, yielding a cell cycle distribution similar to that of control cells.
|
-OHE1 and 2-ME2 on cyclin D1 protein and cyclin D1 transactivation
To investigate the mechanism by which 2-ME2 inhibited E2- and 16
-OHE1-induced G1 to S phase progression of MCF-7 cells, we tested its effect on cyclin D1 protein levels. Cells were treated with E2, 16
-OHE1 2-ME2 or ICI 182,780 for 7 h, and the cell lysate was analyzed by Western blotting. The 7-h time point was selected from our previous study showing the maximal induction of cyclin D1 by E2 and 16
-OHE1 at 68 h (Lewis et al. 2001). There was a fourfold increase in cyclin D1 protein level by both E2 and 16
-OHE1at the 7-h time point, compared with control (Fig. 3A
). In contrast, there was no significant change in cyclin D1 protein level in cells treated with 4, 10 or 100 nM 2-ME2 compared with the control group. However, 2-ME2 was able to prevent the increase in cyclin D1 protein expression in the presence of E2 and 16
-OHE1 (Fig. 3B
). This effect was comparable to that produced by the pure antiestrogen, ICI 182,780 (Fig. 3B
). Thus, a possible mechanism for the ability of 2-ME2 to retard cell-cycle progression mediated by E2 and 16
-OHE1 might involve the suppression of cyclin D1.
|
-OHE1 and 2-ME2 on cyclin D1 transactivation using a full-length cyclin D1 promoter plasmid (1745CD1 LUC). Treatment of cells with either E2 or 16
-OHE1 resulted in 7- and 9.5-fold increases respectively in cyclin D1 promoter (1745CD1 LUC) activity as compared with the control (Fig. 4A
-OHE1, however, 2-ME2 significantly reduced the stimulatory effects of these compounds (Fig. 4A
-OHE1 (Fig. 4A
|
-OHE1, we performed transfection experiments with a cyclin D1 promoter plasmid containing a mutated CRE/ATF site (1745 CRE/ATFmutLUC). Mutation of the CRE/ATF site significantly reduced cyclin D1 transactivation in the presence of E2 and 16
-OHE1 (Fig. 4B
-OHE1.
To test the importance of the distal region of the cyclin D1 promoter in its transcriptional activation by E2 and 16
-OHE1, we used a cyclin D1 promoter plasmid lacking regions 1745 to 964 (963CD1 LUC). Our results (Fig. 5
, upper panel, compared with Fig. 4A
) showed that the removal of the distal region did not have a significant effect on cyclin D1 transcriptional activation by E2 or 16
-OHE1. Furthermore, mutation of the AP-1 site had no marked effect on the induction of cyclin D1 by E2 or 16
-OHE1 (Fig. 5
, lower panel).
|
B site (66CD1 LUC). Our results showed that transactivation of the 66CD1 LUC promoter increased by sixfold in the presence of E2 and by 7.5-fold in the presence of 16
-OHE1, and this induction was significantly inhibited (four- to fivefold) by ICI 182,780 and 2-ME2 (Fig. 6A
B site did not significantly reduce cyclin D1 promoter activity induced by E2 or 16
-OHE1 (Fig. 6C
|
-OHE1 and 2-ME2 on ATF-2 binding to CRE/ATF element
In this series of experiments, we examined the effects of E2, 16
-OHE1 and 2-ME2 on the binding of ATF-2 to a 74-mer ODN1 from cyclin D1 promoter. Cells were treated with 10 nM E2, 16
-OHE1 or 2-ME2, as single agents, or E2 and 2-ME2 combinations for 7 h. A cellular extract was prepared, and binding to ODN1 determined by DNA affinity assay. (The specificity of the assay was verified with a mutant 74-mer ODN with a 3 base pair mutation at the ATF-2 binding site.) Figure 7
shows our results from DNA affinity assay with the wild-type 74-mer ODN. There was very little constitutive binding of ATF-2 to ODN1 in the absence of treatment. Treatment of cells with E2 resulted in a two-to threefold increase (n=3) in ATF-2 binding to ODN1, while 16
-OHE1 caused a fourfold increase (n=3) (Fig. 7
). In contrast, treatment of cells with 2-ME2 resulted in a relatively minor band of ATF-2 binding. Importantly, 2-ME2 blocked the effects of both E2 and 16
-OHE1 treatment on ATF-2 binding to ODN1 (Fig. 7A
). This inhibitory effect was similar to that observed with ICI 182,780 (Fig. 7B
). To verify that the increase in ATF-2 binding was due to phosphorylation, membrane (Fig. 7A
) was stripped and reblotted with a phospho-ATF-2 specific antibody. The binding of phosphorylated ATF-2 to ODN1 was increased by 2.5-fold in the presence of E2 and by fourfold in the presence of 16
-OHE1, compared with control cells. In the presence of 2-ME2, the effects of E2 and 16
-OHE1 were significantly reduced (Fig. 7C
). These results show that both E2 and 16
-OHE1 enhanced the DNA- binding activity of ATF-2 through its phosphorylation, and that 2-ME2 downregulated this process.
|
B-p65/p50 in MCF-7 cells to test the effects of E2, 16
-OHE1 and 2-ME2. Our results showed that these transcription factors bound to ODN1 constitutively; however, c-Jun and c-Fos binding was altered by E2 or 16
-OHE1 treatment (Fig. 8
-OHE1 the binding of c-Jun increased by twofold over the control. Treatment with 2-ME2, as a single agent, or in combination with E2 or 16
-OHE1, caused a significant reduction of both c-Fos and c-Jun binding to ODN1.
|
We next performed transfection studies using an ATF-2 dominant negative mutant to verify the importance of ATF-2 protein in cyclin D1 activation. Cells were transfected with the full-length cyclin D1 reporter plasmid along with dominant negative mutant expression vector. After transfection, cells were treated with 10 nM E2 or 16
-OHE1 in the presence or absence of 2-ME2 for 7 h, and cyclin D1 luciferase activity was measured. Our results (Fig. 9
) showed that transfection of cells with the ATF-2 dominant negative mutant resulted in a significant reduction (four- to sixfold) of E2-and 16
-OHE1-induced cyclin D1 transactivation. ATF-2 dominant negative mutant in the presence of 2-ME2 further suppressed cyclin D1 promoter activity. In contrast, overexpression of the ATF-2 wild-type protein partially reversed the inhibitory effects of 2-ME2 on cyclin D1 transactivation, confirming the importance of ATF-2 in the action of 2-ME2.
|
ATF-2 is activated by phosphorylation, in part, by p38 MAPK (Waas et al. 2001, Recio et al. 2002). We therefore examined phosphorylation of p38 MAPK in MCF-7 cells. Cells were treated with 10 nM E2 or 16
-OHE1, in the presence or absence of 10 nM 2-ME2 or 100 nM ICI 182,780, and p38 MAPK was detected by Western blotting. Our results (Fig. 10
) show that E2 or 16
-OHE1 caused a threefold increase in the level of phospho-p38 MAPK as compared with the control. In contrast, 2-ME2 when combined with E2 or 16
-OHE1, significantly reduced the level of phospho-p38 MAPK. ICI 182,780 also significantly reduced the effect of E2 and 16
-OHE1 on phospho-p38 levels (Fig. 10
). These results indicate that E2 and its metabolites altered p38 MAPK activity, and suggest a mechanism for the activation of ATF-2.
|
| Discussion |
|---|
|
|
|---|
-OHE1 significantly enhanced cyclin D1 protein level compared with the control. Transient transfection experiments, using a full-length cyclin D1 promoter construct, show that E2 and 16
-OHE1 increased cyclin D1 promoter activity by 7.5- and 9.5-fold respectively, whereas 2-ME2 reduced the stimulatory effects of these compounds. Our results also show that transactivation of cyclin D1 by E2 and 16
-OHE1 is mediated by the CRE/ATF motif. E2 and 16
facilitated the binding of ATF-2 to the CRE/ATF motif. Increase in DNA binding of ATF-2 was associated with phosphorylation of ATF-2 and p38 MAPK, events that were significantly inhibited by 2-ME2 and ICI 182,780. These results indicate that estrogenic induction of cyclin D1 transcription involves the p38 phosphorylation cascade that is inhibited by 2-ME2.
E2 was shown to upregulate the levels of cyclin D1 at the mRNA and protein levels along with other critical mediators of cell cycle progression (Altucci et al. 1996, 1997, Foster & Wimalasena 1996, Prall et al. 1997, Doisneau-Sixou et al. 2003). Although E2-induced regulation of cyclin D1 transcription has been established by these and other studies, the molecular mechanism or mechanisms are complex and poorly defined (Planas-Silva et al. 1999, Sabbah et al. 1999, Foster et al. 2001). It is important to note that the cyclin D1 promoter does not contain an ERE element; however, it contains regulatory elements for ATF-2, AP-1, CREB, NF-
B, E2F and SP-1, all of which have been shown to regulate its gene expression (Pestell et al. 1999, Sutherland & Musgrove 2004).
We found that the CRE/ATF site, located at position -54 from the transcriptional start site of the cyclin D1 promoter was required for the induction of cyclin D1 by E2 and 16
-OHE1. Mutation of this site led to a dramatic reduction (6080%) in the cyclin D1 promoter activity induced by these agents (Figs 4B
and 6B
). The marked increase in the DNA binding of ATF-2 in the presence of E2 and 16
-OHE1 and its inhibition by 2-ME2 support the role of CRE/ATF-2 site. However, there was about a twofold induction of cyclin D1 promoter activity in ATF/CRE mutant constructs in the presence of E2. The low level of promoter activity in ATF/CREMUT constructs could be attributed to the binding of AP-1 proteins through consensus or AP-1-like elements. Increased binding of c-Jun and c-Fos to the cyclin D1 promoter fragment supports the role of AP-1 proteins in E2-induced cyclin D1 transactivation. In contrast, the binding of ATF-1, CREB or NF-
B proteins to the cyclin D1 promoter fragment did not show any change in the presence of E2, 16
-OHE1 or 2-ME2. These results are consistent with previous reports on the roles of the CRE/ATF and AP-1 sites in cyclin D1 gene activation (Brown et al. 1998, Beier et al. 1999, Lee et al. 1999, Liu et al. 2002). However, mutation of the AP-1 site, while retaining the ATF/CRE site, did not affect cyclin D1 promoter activity. The ability of ATF/CREB proteins to form selective heterodimers with AP-1 proteins (Uht et al. 1997, Chinenov & Kerppola 2001), the presence of AP-1-like elements (GACTA versus the consensus AP-1 element TGACTAA) close to the ATF/CRE site and the ability of ER
to interact with the Jun protein (Teyssier et al. 2001) might be important factors in the flexibility of the cyclin D1 transcriptional response.
ICI 182,780 could inhibit cyclin D1 promoter activity induced by E2 and 16
-OHE1, suggesting that activation of cyclin D1 involves the function of the ER. ICI 182,780 is able to inhibit nongenomic action of E2, such as the activation of the phosphorylation cascade (Wade et al. 2001, Kinoshita & Chen 2003). ICI 182,780 binding of ER
provides it with a unique conformational state, interrupting proteinprotein associations (Weatherman et al. 2002, Margeat et al. 2003). In addition, ligand-induced alterations in signaling pathways determine the availability and homo/heterodimer formation between ATF-2, c-Jun and c-Fos, leading to their binding to the CRE/ATF motif of the cyclin D1 promoter. The formation of these multiprotein complexes and their DNA binding appears to be facilitated by the presence of E2 and 16
-OHE1, but disrupted by 2-ME2 and ICI 182,780.
While the ability of 2-ME2 to inhibit E2-induced growth stimulation suggests that it might be functioning like an antiestrogen, 2-ME2 does not have the properties of ICI 182,780 or other antiestrogens. 2-ME2 has very low binding affinity for ER (~1% that of E2) (Dubey et al. 2000, Brueggemeier et al. 2001) and inhibits both ER-positive and ER-negative tumor growth (Robertson 2001, Schumacher & Neuhaus 2001). However, binding affinity does not always correlate with biologic activity. Previous studies have indicated that 16
-OHE1 binds to the classical ER
with an affinity ~10% of that of E2; however, it is as potent as E2 in stimulating uterine growth (Suto et al. 1999). 16
-OHE1 was slightly more potent than E2 in stimulating DNA synthesis, cell cycle progression and cyclin D1 expression in MCF-7 cells (Lewis et al. 2001). Hence, the antiestrogenic effects of 2-ME2 might not be dependent on its high affinity binding to the classical ER. Alternatively, as suggested by Kousteini et al.(2001), the classical binding assays may not capture the efficiency of ligand association rates, but rather the ratio of association to dissociation rates.
It is also possible that 2-ME2 may utilize a receptor that is distinct from the classical ER. Potential receptors include: 1. the type II ER (Markaverich & Clark 1987, Shoulars et al. 2002); 2. one or more of the variants of ER
or ERß (Fuqua et al. 1991) and 3. certain members of the nuclear orphan receptor family (Laudet et al. 1992). Plasma membrane ER that mediates rapid activation of signaling pathways in response to E2 is found in target cells (Migliaccio et al. 1996, Falkenstein et al. 2000, Kousteni et al. 2001). Although plasma membrane ER is reported to be similar to the classical nuclear ER
, unique ligand specificity might exist due to ER association with scaffold proteins, such as caveolin (Razandi et al. 1999, Marquez & Pietras 2001, Song et al. 2004). Therefore, E2 and 16
-OHE1 can utilize a number of signaling pathways other than the classical ER pathway to stimulate the transcription of cyclin D1. The mechanism of 2-ME2 in antagonizing the effects of E2 appears to involve a blockade of estrogenic signaling through p38 MAPK and ATF-2 phosphorylation.
ATF-2 is phosphorylated by JNK/SAPK and p38 MAP kinases, in response to cellular stress (van Dam et al. 1995, Raingeaud et al. 1996), and by extracellular signal-regulated kinases (ERK), in response to growth factors (Albanese et al. 1995,Watanabe et al. 1996). Phosphorylation of ATF-2 increases its transcriptional activity by relieving intramolecular inhibitory interaction between the DNA-binding domain and the transactivating domain (Abdel-Hafiz et al. 1992, Kawasaki et al. 2000). In our experiments, increased ATF-2 binding to DNA was facilitated by ATF-2 phosphorylation and associated cyclin D1 transcriptional activation. Activation of p38 MAPK appears to be responsible for ATF-2 phosphorylation, since a three- to fourfold higher level of phosphorylated p38 MAPK is found in cells treated with E2 and 16
-OHE1 than in control cells. 2-ME2 blocked the stimulatory effects of E2 and 16
-OHE1 on ATF-2 phosphorylation and cyclin D1 promoter activation. The inhibitory effect of 2-ME2 might be due to reduced phosphorylation of p38 MAPK. However, it is not known what step of the signaling cascade, leading to the phosphorylation of p38 MAPK, is inhibited by 2-ME2.
Activation of p38 MAPK might be mediated by nongenomic action of estrogens. Recent studies reveal many instances of estrogenic action with activation of Src/Shc/ERK signaling pathways by ER
located on membrane sites of target cells (Castoria et al. 2001, Kousteni et al. 2001, Song et al. 2002, 2004). Estrogenic action may include ER interaction with the G protein-coupled receptor, GPCR30, which stimulates adenylyl cyclase activity, leading to the production of cAMP and associated signaling (Aronica et al. 1994, Filardo et al. 2002). Alternatively, E2 stimulation of MCF-7 cells may induce a direct interaction between ER
, Src and the p85 subunit of phosphatidylinositol (PI)3-kinase, thereby activating the PI3K/Akt pathway (Migliaccio et al. 1996). In another study, the HER-2 signaling pathway was implicated in E2-induced activation of Akt (Stoica et al. 2003). Akt may activate p38 MAPK (Madrid et al. 2001). Further studies are needed to validate the involvement of these pathways in the activation of p38 MAPK by E2.
Previous studies indicated that 2-ME2 inhibits DNA synthesis in MCF-7 and MDA-MB-231 breast cancer cells (Seegers et al. 1989, Brueggemeier et al. 2001, Schumacher & Neuhaus 2001). In human prostate cancer, 2-ME2 inhibited tumor growth by arresting cells in the G2/M phase of the cell cycle (Kumar et al. 2001). The 2-ME2-induced G2/M block, occurring at 3 µM concentration, was associated with a significant increase in p21 and cdc2 expression. An effect of 2-ME2 on tubulin polymerization has been reported at 3 µM or higher concentration (Cushman et al. 1995, Klauber et al. 1997, Pribluda et al. 2000). In the osteosarcoma 143 B cell line, a dual effect of 2-ME2 on cell cycle was observed with G1 arrest at 1 µM level and G2/M arrest at 10 µM level (Golebiewska et al. 2002). We found that 2-ME2 is effective in blocking the stimulatory effects of E2 and 16
-OHE1 on DNA synthesis, and G1 to S phase progression. The increased expression of cyclin D1 caused by E2 and 16
-OHE1 is downregulated by 2-ME2. In the absence of E2, the low level of DNA synthesis found in phenol red-free cells is inhibited by 2-ME2, although this was not sufficient to be detected as a cell cycle arrest by flow cytometry. Thus, in the absence of E2, MCF-7 cells remain largely (7782%) in the G1 phase in the presence or absence of low concentrations of 2-ME2. This may be because breast cancer cells with low growth fraction are more resistant to the action of antiproliferative agents than log-phase cells (Carlisle et al. 2002).
In summary, our results show that E2 and 16
-OHE1 stimulate cell growth and cell cycle progression by upregulating cyclin D1 expression, whereas 2-ME2, like an antiestrogen, blocks the stimulatory effects of E2 and 16
-OHE1. Estrogenic regulation of the cyclin D1 gene occurs at the transcriptional level and is mediated by the CRE/ATF-2 element, located at -54 upstream of the cyclin D1 promoter transcription start site. Transcriptional activation of cyclin D1 by E2 and 16
-OHE1 is dependent on phosphorylation and binding of ATF-2 to the CRE/ATF motif. Our results demonstrate an antiestrogenic effect of 2-ME2 in MCF-7 breast cancer cells, and suggest that cyclin D1 might be a key target in the growth-inhibitory actions of 2-ME2. Our results also indicate that transduction of the estrogenic signal for cell proliferation includes phosphorylation cascades involving the activation of p38 MAP kinase.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Albanese C, Johnson J, Watanabe G, Eklund N, Vu D, Arnold A & Pestell RG 1995 Transforming p21 ras mutants and c-Ets-2 activate the cyclin D1 promoter through distinguishable regions. Journal of Biological Chemistry 270 2358923597.
Altucci L, Addeo R, Cicatiello L, Dauvois S, Parker MG, Truss M, Beato M, Sica V, Bresciani F & Weisz A 1996 17ß-Estradiol induces cyclin D1 gene transcription, p36D1-p34 cdk4 complex activation and p105Rb phosphorylation during mitogenic stimulation of G(1)-arrested human breast cancer cells. Oncogene 12 23152324.[Web of Science][Medline]
Altucci L, Addeo R, Cicatiello L, Germano D, Pacilio C, Battista T, Cancemi M, Petrizzi VB, Bresciani F & Weisz A 1997 Estrogen induces early and timed activation of cyclin-dependent kinases 4, 5, and 6 and increases cyclin messenger ribonucleic acid expression in rat uterus. Endocrinology 138 978984.
Aronica SM, Kraus WL & Katzenellenbogen BS 1994 Estrogen action via the cAMP signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene transcription. PNAS 91 85178521.
Ball P, Knuppen R, Haupt M & Breuer H 1972 Interactions between estrogens and catechol amines. III. Studies on the methylationof catechol estrogens, catechol amines and other catechols by the catechol O-methyltransferase of human liver. Journal of Clinical Enodcrinology and Metabolism 34 736746.
Beier F, Lee RJ, Taylor AC, Pestell RG & LuValle P 1999 Identification of the cyclin D1 gene as a target of activating transcription factor 2 in chondrocytes. PNAS 96 14331438.
Berthois Y, Katzenellenbogen JA & Katzenellenbogen BS 1986 Phenol red in tissue culture media is a weak estrogen: implications concerning the study of estrogen responsive cells in culture. PNAS 83 24962500.
Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C & Darnell JE Jr 1999 Stat3 as an oncogene. Cell 98 295303.[CrossRef][Web of Science][Medline]
Brown JR, Nigh E, Lee RJ, Ye, H, Thompson MA, Saudou F, Pestell RG & Greenberg ME 1998 Fos family members induce cell cycle entry by activitating cyclin D1. Molecular and Cellular Biology 18 56095619.
Brueggemeier RW, Bhat AS, Lovely CJ, Coughenour HD, Joomprabutra S, Weitzel DH, Vandre DD, Yusuf F & Burak WE Jr 2001 2-Methoxymethylestradiol: a new 2-methoxy estrogen analog that exhibits antiproliferative activity and alters tubulin dynamics. Journal of Steroid Biochemistry and Molecular Biology 78 145156.[CrossRef][Web of Science][Medline]
Carlisle DL, Devereux WL, Hacker A, Woster PM & Casero RA Jr 2002 Growth status significantly affects the response of human lung cancer cells to antitumor polyamine-analogue exposure. Clinical Cancer Research 8 26842689.
Castoria G, Migliaccio A, Bilancio A, Di Domenico M, de Falco A, Lombardi M, Fiorentino R, Varricchio L, Barone MV & Auricchio F 2001 PI3-kinase in concert with Src promotes the S-phase entry of oestradiol-stimulated MCF-7 cells. EMBO Journal 20 60506059.[CrossRef][Web of Science][Medline]
Chinenov Y & Kerppola T 2001 Close encounters of many kinds: Fos-Jun interactions that mediate transcription regulatory specificity. Oncogene 20 24382452[CrossRef][Web of Science][Medline]
Cushman M, He HM, Katzenellenbogen JA, Lin CM & Hamel E 1995 Synthesis, antitubulin and antimitotic activity, and cytotoxicity of analogs of 2-methoxyestradiol, an endogenous mammalian metabolite of estradiol that inhibits tubulin polymerization by binding to the colchicine binding site. Journal of Medical Chemistry 38 20412049.
DAmato RJ, Lin CM, Flynn E, Folkman J & Hamel E 1994 2-Methoxyestradiol, an endogenous mammalian metabolite, inhibits tubulin polymerization by interacting at the colchicine site. PNAS 91 39643968.
DAmico M, Hulit J, Amanatullah DF, Zafonte BT, Albanese C, Bouzahzah B, Fu M, Augenlicht LH, Donehower LA, Takemaru K, Moon RT, Davis R, Lisanti MP, Shtutman M, Zhurinsky J, Ben-Zeev A, Troussard AA, Dedhar S & Pestell RG 2000 The integrin-linked kinase regulates the cyclin D1 gene through glycogen synthase kinase 3 beta and cAMP-responsive element-binding protein-dependent pathways. Journal of Biological Chemistry 275 3264932657.
Doisneau-Sixou SF, Sergio CM, Carroll JS, Hui R, Musgrove EA & Sutherland RL 2003 Estrogen and antiestrogen regulation of cell cycle progression in breast cancer cells. Endocrine-Related Cancer 10 179186.[Abstract]
Dubey RK, Gillespie DG, Zacharia LC, Rosselli M, Korzekwa KR, Fingerle J & Jackson EK 2000 Methoxyestradiols mediate the antimitogenic effects of estradiol on vascular smooth muscle cells via estrogen receptor-independent mechanisms. Biochemical and Biophysical Research Communications 278 2733.[CrossRef][Web of Science][Medline]
Falkenstein E, Tillmann HC, Christ M, Feuring M & Wehling M 2000 Multiple actions of steroid hormones a focus on rapid, nongenomic effects. Pharmacological Reviews 52 513556.
Filardo EJ, Quinn JA, Frackelton AR Jr & Bland KI 2002 Estrogen action via the G protein-coupled receptor, GPR30: stimulation of adenylyl cyclase and cAMP-mediated attenuation of the epidermal growth factor receptor-to-MAPK signaling axis. Molecular Endocrinology 16 7084.
Fishman J & Martucci CP 1980 Biological properties of 16 alpha-hydroxyesterone: implications of estrogen physiology and pathophysiology. Journal of Clinical Endocrinology and Metabolism 51 611615.
Foster JS & Wimalasena J 1996 Estrogen regulates activity of cyclin-dependent kinases and retinoblastoma protein phosphorylation in breast cancer cells. Molecular Endocrinology 10 488498.
Foster JS, Henley DC, Ahamed S & Wimalasena J 2001 Estrogens and cell-cycle regulation in breast cancer. Trends in Endocrinology and Metabolism 12 320327.[CrossRef][Web of Science][Medline]
Fotsis T, Zhang Y, Pepper MS, Adlercreutz H, Montesanno R, Nawroth PP & Schwelgerer L 1994 The endogenous oestrogen metabolite 2-methoxyestradiol inhibits angiogenesis and suppresses tumor growth. Nature 368 237239.[CrossRef][Medline]
Fuqua A, Fitzgerald SD, Chamness GC, Tandon AK, McDonnell DP, Nawaz Z, OMalley BW & McGuire WL 1991 Variant human breast tumor estrogen receptor with constitutive transcriptional activity. Cancer Research 51 105109.
Golebiewska J, Rozwadowski P, Spodnik JH, Knap N, Wakabayashi T & Wozniak M 2002 Dual effect of 2-methoxyestradiol on cell cycle events in human osteosarcoma 143B cells. Acta Biochimica Polonica 49 5965.[Web of Science][Medline]
Gupta S, Campbell D, Derijard B & Davis RJ 1995 Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267 389393.
Gupta M, McDougal A & Safe S 1998 Estrogenic and antiestrogenic activities of 16
- and 2-hydroxy metabolites of 17ß-estradiol in MCF-7 and T47D human breast cancer cells. Journal of Steroid Biochemistry and Molecular Biology 67 413419.[CrossRef][Web of Science][Medline]
Guttridge DC, Albanese C, Reuther JY, Pestell RG & Baldwin AS 1999 NF-ßB controls cell growth and differentiation through transcriptional regulation of cyclin D1. Molecular Cell Biology 19 57855799.
Hai TW, Liu F, Coukos WJ & Green MR 1993 Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes and Development 3 20832090.[CrossRef]
Henderson BE, Ross R & Berstein L 1988 Estrogens as a cause of human cancer: the Richard and Hinda Rosenthal Foundation award lecture. Cancer Research 48 246253.
Herber B, Truss M, Beato M & Muller R 1994 Inducible regulatory elements in the human cyclin D1 promoter. Oncogene 9 12951304.[Web of Science][Medline]
Jefcoate CR, Liehr JG, Santen RJ, Sutter TR, Yager JD, Yue W, Santner SJ, Tekmal R, Demers L, Pauley R, Naftolin F, Mor G & Berstein L 2000 Tissue-specific synthesis and oxidative metabolism of estrogens. Journal of the National Cancer Institute Monographs 27 95112.
Katazenellenbogen BS, Montano MM, Ediger TR, Sun J, Ekena K, Laz Martini PG, McInerney EM, Delage-Mourrous R, Weis K & Katzenellenbogen JA 2000 Estrogen receptors: selective ligands, partners, and distinctive pharmacology. Recent Progress in Hormone Research 55 163193.
Kawasaki H, Taira K & Yokoyama K 2000 Histone acetyltransferase (HAT) activity of ATF-2 is necessary for the CRE-dependent transcription. Nucleic Acids Symposium Series 44 259260.
Kinoshita Y & Chen S 2003 Induction of aromatase (CYP19) expression in breast cancer cells through a nongenomic action of estrogen receptor alpha. Cancer Research 63 35463555.
Klauber N, Parangi S, Flynn E, Hamel E & DAmato RJ 1997 Inhibition of angiogenesis and breast cancer in mice by the microtubule inhibitors 2-methoxyestradiol and taxol. Cancer Research 57 8186.
Kousteni S, Bellido T, Plotkin LI, OBrien CA, Bodenner DL, Han L, Han K, DiGregorio B, Katzenellenbogen JA, Katzenellenbogen BS, Roberson PK, Weinstein RS, Jilka R & Manolagas SC 2001 Nongenotropic, sex-nonspecific signaling through the estrogen or androgen receptors: dissociation from transcriptional activity. Cell 104 719730.[Web of Science][Medline]
Kumar AP, Garcia GE & Slaga TJ 2001 2-Methoxyestradiol blocks cell-cycle progression at G2/M phase and inhibits growth of human prostate cancer cells. Molecular Carcinogenesis 31 111124.[CrossRef][Web of Science][Medline]
Laudet V, Hanni C, Coll J, Catzeflis F & Stehelin D 1992 Evolution of the nuclear receptor gene superfamily. EMBO Journal 11 10031012.[Web of Science][Medline]
Lee RJ, Albanese C, Stenger RJ, Watanabe G, Inghirami G, Haines GK, Webster M, Muller WJ, Brugge JS, Davis RJ & Pestell RG 1999 pp60 v-src induction of cyclin D1 requires collaborative interactions between the extracellular signal-regulated kinase, p38, and Jun kinase pathways. Journal of Biological Chemistry 274 73417350.
Lewis JS, Thomas TJ, Klinge CM, Gallo MA & Thomas T 2001 Regulation of cell cycle and cyclins by 16
-hydroxyestrone in MCF-7 breast cancer cells. Journal of Molecular Endocrinology 27 293307.[Abstract]
Liu MM, Albanese C, Anderson CM, Hilty K, Webb P, Uht RM, Price RH Jr, Pestell RG & Kushner PJ 2002 Opposing action of estrogen receptors alpha and beta on cyclin D1 gene expression. Journal of Biological Chemistry 277 2435324360.
Livingstone C, Patel G & Jones N 1995 ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO Journal 14 17851797.[Web of Science][Medline]
Lottering ML, Haag M & Seegers JC 1992 Effects of 17 ß-estradiol metabolites on cell cycle events in MCF-7 cells. Cancer Research 52 59265932.
Madrid LV, Mayo MW, Reuther JY & Baldwin AS Jr 2001 Akt stimulates the transactivation potential of the RelA/p65 subunit of NF-kappa B through utilization of the Ikappa B kinase and activation of the mitogen-activated protein kinase p38. Journal of Biological Chemistry 276 1893418940.
Margeat E, Bourdoncle A, Margueron R, Poujol N, Cavailles V & Royer C 2003 Ligands differentially modulate the protein interactions of the human estrogen receptors alpha and beta. Journal of Molecular Biology 326 7792.[CrossRef][Web of Science][Medline]
Markaverich BM & Clark JH 1979 Two binding sites for estradiol in rat uterine nuclei: relationship to uterotropic response. Endocrinology 105 14581462.
Marquez DC & Pietras RJ 2001 Membrane-associated binding sites for estrogen contribute to growth regulation of human breast cancer cells. Oncogene 20 54205430.[CrossRef][Web of Science][Medline]
Martucci CP & Fishman 1993 J P450 enzymes of estrogen metabolism. Pharmacological Therapy 57 237257.
McKenna NJ & OMalley BW 2002 Minireview: nuclear receptor coactivators an update. Endocrinology 143 24612465.
Migliaccio A, Di Domenico M, Castoria G, de Falco A, Bontempo P, Nola E & Auricchio F 1996 Tyrosine kinase/p21 reas/MAP-kinase pathway activation by estradiol-receptor complex in MCF-7 cells. EMBO Journal 15 12921300.[Web of Science][Medline]
Mooberry SL 2003 Mechanism of action of 2-methoxyestradiol: new developments. Drug Resistance Updates 6 355361.[CrossRef][Web of Science][Medline]
Musgrove EA, Lee CS, Buckley MF & Sutherland RL 1994 Cyclin D1 induction in breast cancer cells shortens G1 and is sufficient for cells arrested in G1 to complete the cell cycle. PNAS 91 80228026.
Muti P, Bradlow HL, Micheli A, Krogh V, Freudenheim JL, Schunemann HJ, Stanulla M, Yang J, Sepkovic DW, Trevisan M & Berrino F 2000 Estrogen metabolism and risk of breast cancer: a prospective study of the 2:16 alpha-hydroxyestrone ratio in premenopausal and postmenopausal women. Epidemiology 11 635640.[CrossRef][Web of Science][Medline]
Nilsson S & Gustafsson JA 2002 Estrogen receptor action. Critical Reviews in Eukaryotic Gene Expression 12 237257.[CrossRef][Web of Science][Medline]
Pacilio C, Germano D, Addeo R, Altucci L, Petrizzi VB, Cancemi M, Cicatiello L, Salzano S, Lallemand F, Michalides RJ, Bresciani F & Weisz A 1998 Constitutive overexpression of cyclin D1 does not prevent inhibition of hormone-responsive human breast cancer cell growth by antiestrogens. Cancer Research 58 871876.
Pestell RG, Albanese C, Reutens AT, Segall JE, Lee RJ & Arnold A 1999 The cyclins and cyclin-dependent kinase inhibitors in hormonal regulation of proliferation and differentiation. Endocrine Reviews 20 501534.
Planas-Silva MD, Donaher JL & Weinberg RA 1999 Functional activity of ectopically expressed estrogen receptor is not sufficient for estrogen-mediated cyclin D1 expression. Cancer Research 59 47884792.
Prall OW, Sarcevic B, Musgrove EA, Watts CK & Sutherland RL 1997 Estrogen-induced activation of Cdk4 and Cdk2 during G1-S phase progression is accompanied by increased cyclin D1 expression and decreased cyclin-dependent kinase inhibitor association with cyclin E-Cdk2. Journal of Biological Chemistry 272 1088210894.
Pribluda VS, Gubish ER Jr, Lavallee TM, Treston A, Swartz GM & Green SJ 2000 2-Methoxyestradiol: an endogenous antiangiogenic and antiproliferative drug candidate. Cancer and Metastasis Reviews 19 173179.[CrossRef][Web of Science][Medline]
Raingeaud J, Whitmarsh AJ, Barrett T, Derijard B & Davis RJ 1996 MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Molecular and Cellular Biology 16 12471255.
Razandi M, Pedram A, Greene GL & Levin ER 1999 Cell membrane and nuclear estrogen receptors derive from a single transcript: studies of ER
and ERß expressed in CHO cells. Molecular Endocrinology 13 307319.
Recio JA & Merlino G 2002 Hepatocyte growth factor/scatter factor activates proliferation in melanoma cells through p38 MAPK, ATF-2 and cyclin D1. Oncogene 2 10001008.
Robertson JF 2001 Faslodex (ICI 182, 780), a novel estrogen receptor downregulator future possibilities in breast cancer. Journal of Steroid Biochemistry and Molecular Biology 79 209212.[CrossRef][Web of Science][Medline]
Russo J, Hasan Lareef M, Balogh G, Guo S & Russo IH 2003 Estrogen and its metabolites are carcinogenic agents in human breast epithelial cells. Journal of Steroid Biochemistry and Molecular Biology 87 125.[CrossRef][Web of Science][Medline]
Sabbah M, Courilleau D, Mester J & Redeuilh G 1999 Estrogen induction of the cyclin D1 promoter: involvement of a cAMP response-like element. PNAS 96 1121711222.
Schumacher G & Neuhaus P 2001 The physiological estrogen metabolite 2-methoxyestradiol reduces tumor growth and induces apoptosis in human solid tumors. Journal of Cancer Research and Clinical Oncology 127 405410.[CrossRef][Web of Science][Medline]
Seegers JC, Aveling M-L, van Aswegen CH, Cross M, Koch F & Joubert WS 1989 The cytotoxic effects of estradiol-17ß, catecholestradiols, and methoxyestradiols on dividing MCF-7 and HeLa cells. Journal of Steroid Biochemistry 32 797809.[CrossRef][Web of Science][Medline]
Shah N, Thomas TJ, Lewis JS, Klinge CM, Shirahata A, Gelinas C & Thomas T 2001 Regulation of estrogenic and nuclear factor kappa B functions by polyamines and their role in polyamine analog-induced apoptosis of breast cancer cells. Oncogene 20 17151729.[CrossRef][Web of Science][Medline]
Shoulars K, Brown T, Alejandro MA, Crowley J & Markaverich BM 2002 Identification of nuclear type II [(3)H]estradiol binding sites as histone H4. Biochemical and Biophysical Research Communications 296 10831090.[CrossRef][Web of Science][Medline]
Sicinski P & Weinberg RA 1997 A specific role for cyclin D1 in mammary gland development. Journal of Mammary Gland Biology and Neoplasia 2 335342.[CrossRef][Medline]
Song RX, McPherson RA, Adam L, Bao Y, Shupnik M, Kumar R & Santen RJ 2002 Linkage of rapid estrogen action to MAPK activation by ERalpha-Shc association and Shc pathway activation. Molecular Endocrinology 16 116127.
Song RX, Barnes CJ, Zhang Z, Bao Y, Kumar R & Santen RJ 2004 The role of Shc and insulin-like growth factor 1 receptor in mediating the translocation of estrogen receptor alpha to the plasma membrane. PNAS 101 20762081.
Stoica GE, Franke TF, Wellstein A, Czubayko F, List HJ, Reiter R, Morgan E, Martin MB & Stoica A 2003 Estradiol rapidly activates Akt via the ErbB2 signaling pathway. Molecular Endocrinology 17 818830.
Suto A, Telang NT, Tanino H, Takeshita T, Ohmiya H, Osborne MP & Kubota T 1999 In vitro and in vivo modulation of growth regulation in the human breast cancer cell line MCF-7 by estradiol metabolites. Breast Cancer 6 8792.[Medline]
Sutherland RL & Musgrove EA 2004 Cyclins and breast cancer. Journal of Mammary Gland Biology and Neoplasia 9 95104.[CrossRef][Web of Science][Medline]
Teyssier C, Belguise K, Galtier F & Chalbos D 2001 Characterization of the physical interaction between estrogen receptor alpha and JUN proteins. Journal of Biological Chemistry 276 3636136369.
Thomas T & Thomas TJ 1994 Regulation of cyclin B1 by estradiol and polyamines in MCF-7 breast cancer cells. Cancer Research 54 10771084.
Thomas T, Trend B, Butterfield JR, Janne OA & Kiang DT 1989 Regulation of ornithine decarboxylase gene expression in MCF-7 breast cancer cells by antiestrogens. Cancer Research 49 58525857.
Thomas T, Gallo MA & Thomas TJ 2004 Estrogen receptors as targets of drug development for breast cancer, osteoporosis and cardiovascular diseases. Current Cancer Drug Targets 4 483499.[CrossRef][Web of Science][Medline]
Uht RM, Anderson CM, Webb P & Kushner PJ 1997 Transcriptional activities of estrogen and glucocorticoid receptors are functionally integrated at the AP-1 response element. Endocrinology 138 29002908.
van Dam H, Wilhelm D, Herr I, Steffen A, Herrlich P & Angel P 1995 ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to genotoxic agents. EMBO Journal 14 17981811.[Web of Science][Medline]
Waas WF, Lo HH & Dalby KN 2001 The kinetic mechanism of the dual phosphorylation of the ATF2 transcription factor by p38 mitogen-activated protein (MAP) kinase alpha. Implications for signal/response profiles of MAP kinase pathways. Journal of Biological Chemistry 276 56765684.
Wade CB, Robinson S, Shapiro RA & Dorsa DM 2001 Estrogen receptor (ER)alpha and ERbeta exhibit unique pharmacologic properties when coupled to activation of the mitogen-activated protein kinase pathway. Endocrinology 142 23362342.
Wang TC, Cardiff RD, Zukerberg L, Lees E, Arnold A & Schmidt EV 1994 Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. Nature 369 669671.[CrossRef][Medline]
Watanabe G, Howe A, Lee RJ, Albanese C, Shu IW, Karnezis AN, Zon L, Kyriakis J, Rundell K & Pestell RG 1996 Induction of cyclin D1 by simian virus 40 small tumor antigen. PNAS 93 1286112866.
Watanabe G, Albanese C, Lee RJ, Reutens A, Vairo G, Henglein B & Pestell RG 1998 Inhibition of cyclin D1 kinase activity is associated with E2F-mediated inhibition of cyclin D1 promoter activity through E2F and Sp1. Molecular and Cellular Biology 18 32123222.
Weatherman RV, Chang CY, Clegg NJ, Carroll DC, Day RN, Baxter JD, McDonnell DP, Scanlan TS & Schaufele F 2002 Ligand-selective interactions of ER detected in living cells by fluorescence resonance energy transfer. Molecular Endocrinology 16 487496.
Yamakawa K & Arita J 2004 Cross-talk between the estrogen receptor-, protein kinase A-, and mitogen-activated protein kinase-mediated signaling pathways in the regulation of lactotroph proliferation in primary culture. Journal of Steroid Biochemistry and Molecular Biology 88 123130.[CrossRef][Web of Science][Medline]
Zhu BT & Conney AH 1998 Is 2-methoxyestradiol an endogenous estrogen metabolite that inhibits mammary carcinogenesis? Cancer Research 58 22692277.
Zwijsen RM, Buckle RS, Hijmans EM, Loomans CJ & Bernards R 1998 Ligand-independent recruitment of steroid receptor coactivators to estrogen receptor by cyclin D1. Genes and Development 12 34883498.
Received 15 July 2004
Accepted 13 September 2004
Made available online as an Accepted Preprint 29 September 2004
This article has been cited by other articles:
![]() |
S. V. Rajkumar, P. G. Richardson, M. Q. Lacy, A. Dispenzieri, P. R. Greipp, T. E. Witzig, R. Schlossman, C. F. Sidor, K. C. Anderson, and M. A. Gertz Novel Therapy with 2-Methoxyestradiol for the Treatment of Relapsed and Plateau Phase Multiple Myeloma Clin. Cancer Res., October 15, 2007; 13(20): 6162 - 6167. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Straub The Complex Role of Estrogens in Inflammation Endocr. Rev., August 1, 2007; 28(5): 521 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Salih, X. Xu, T. D. Veenstra, A. J. Duleba, H. Fouad, M. Nagamani, and A. Al-Hendy Lower Levels of Urinary 2-Hydroxyestrogens in Polycystic Ovary Syndrome J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 3285 - 3291. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Cascio, V. Bartella, C. Garofalo, A. Russo, A. Giordano, and E. Surmacz Insulin-like Growth Factor 1 Differentially Regulates Estrogen Receptor-dependent Transcription at Estrogen Response Element and AP-1 Sites in Breast Cancer Cells J. Biol. Chem., February 9, 2007; 282(6): 3498 - 3506. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Chung, M. C. Ostrowski, T. Romigh, T. Minaguchi, K. A. Waite, and C. Eng The ERK1/2 pathway modulates nuclear PTEN-mediated cell cycle arrest by cyclin D1 transcriptional regulation Hum. Mol. Genet., September 1, 2006; 15(17): 2553 - 2559. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Vijayanathan, S. Venkiteswaran, S. K. Nair, A. Verma, T.J. Thomas, B. T. Zhu, and T. Thomas Physiologic levels of 2-methoxyestradiol interfere with nongenomic signaling of 17beta-estradiol in human breast cancer cells. Clin. Cancer Res., April 1, 2006; 12(7 Pt 1): 2038 - 2048. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Agrawal and C. Eng Differential expression of novel naturally occurring splice variants of PTEN and their functional consequences in Cowden syndrome and sporadic breast cancer Hum. Mol. Genet., March 1, 2006; 15(5): 777 - 787. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |