JME
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Journal of Molecular Endocrinology (2005) 34 19-35    DOI: 10.1677/jme.1.01608
© 2005 Society for Endocrinology

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bailey, J.
Right arrow Articles by Europe-Finner, G N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bailey, J.
Right arrow Articles by Europe-Finner, G N.

Identification of human myometrial target genes of the c-Jun NH2-terminal kinase (JNK) pathway: the role of activating transcription factor 2 (ATF2) and a novel spliced isoform ATF2-small

Jarrod Bailey and G Nicholas Europe-Finner

School of Surgical and Reproductive Sciences, The Medical School, University of Newcastle upon Tyne, Newcastle upon Tyne NE2 4HH, UK

(Requests for offprints should be addressed to J Bailey; Email: jarrod.bailey{at}ncl.ac.uk)


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Activating transcription factor 2 (ATF2), a ubiquitously expressed member of the basic region leucine zipper (bZIP) family of transcription factors activated by mitogen activated protein kinase (MAPK) pathways, is important in the mediation of cellular stress responses, development and transformation. We have previously reported the differential expression of active ATF2 in the human myometrium throughout pregnancy and labour, and identified and partially characterized a novel splice variant ATF2-small (ATF2-sm). To further understand the role of these factors in the myometrium, we have used gene microarrays to define the target genes in cultured myometrial cells stably-transfected with ATF2 and ATF2-sm cDNAs. Many of the genes identified appear to have potential roles in regulating myometrial function and include proteins involved in G-protein receptor signalling, cytokine signalling, transcriptional regulation, cell-cycle control, formation of the extracellular matrix and cytoskeletal architecture. ATF2 was found to affect the expression of 204 genes; 113 being up-regulated and 91 down-regulated whereas the novel ATF2-sm factor altered the expression of 55 genes; expression was increased in 29 cases and decreased in 26. A further 25 genes affected by ATF2-sm were identified by suppression subtractive hybridisation (SSH). Notably, the genes affected by ATF2 and ATF2-sm appear to belong to discrete groups: only two genes were affected by both factors.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Activating transcription factor 2 (ATF2) is a ubiquitously expressed member of the basic region leucine zipper (bZIP) transcription factor family (Landschulz et al. 1988, Ziff EB 1990), which includes other factors such as cyclic-AMP response-element binding protein (CREB) (Hoeffler et al. 1988), the highly spliced cyclic-AMP response-element modulator protein (CREM) (Foulkes et al. 1991), and other members of the ATF family. ATF2 plays an important role in mediating cellular stress responses, development and transformation (Hai et al. 1989, Maekawa et al. 1989, Abdel-Hafiz et al. 1992, Karin & Hunter 1995, Reimold et al. 1996, Ronai et al. 1998, Maekawa et al. 1999, van Dam & Castellazzi 2001), and its trans-activation potential is enhanced via phosphorylation at amino acid residues Thr69 and Thr71 (Davis 2000, Fuchs et al. 2000) by the mitogen activated protein kinases (MAPK) JNK/SAPK, p38 (Derijard et al. 1994, Gupta et al. 1995, Livingstone et al. 1995, van Dam et al. 1995, Raingeaud et al. 1996, Read et al. 1997, Chang & Karin 2001, Kyriakis & Avruch 2001), and the Ras effector pathways Raf-MEK-ERK and Ral-RalGDS-Src-p38 (Ouwens et al. 2002). It modulates the expression of downstream-affected genes by binding either as a homo- or hetero-dimer with other members of the bZIP family (Hai & Curran 1991) to cAMP response elements (CREs) and Activator Protein-1 (AP-1) sites within their promoter regions (Montminy et al. 1986, Lee et al. 1987, Yamamoto et al. 1988). Transcriptional activation is promoted via the intrinsic histone acetyl transferase (HAT) activity of ATF2 (Kawasaki et al. 2000), and by recruitment of co-activators such as p300/CBP (Cho et al. 2001). Interaction of ATF2 with p300/CBP and the basal transcriptional machinery is dependent upon phosphorylation at Ser121 within its p300 interaction domain (Kawasaki et al. 1998), mediated by protein kinase C{alpha} (PKC); it has been suggested that Ser121-unphosphorylated ATF2 is transcriptionally silent, necessitating the use of constitutively active ATF2 mutants in transcription studies (Steinmuller & Thiel 2003). However, we have reported highly significant trans-activation of CRE-containing reporter genes by transient transfection of an ATF2-expressing plasmid into both myometrial and COS-7 cell lines (Bailey et al. 2002). Furthermore, we present data here to indicate promiscuous transcriptional modification in myometrial cell lines stably transfected with ATF2 constructs.

Recently we have shown that various members of the bZIP transcription factor family including ATF2 are differentially expressed in the human myometrium during gestation and parturition (Bailey et al. 2002). However, in addition to the well characterized 60 000 mol wt ATF2 protein, we also reported the existence of a novel putative splice-variant designated ATF2-small (ATF2-sm) (Bailey et al. 2000), showing potent trans-activation properties. To our knowledge, this is the first alternatively-spliced variant of ATF2 to be identified in human tissue. Although comprising 432 bp and translating to a polypeptide of 144 amino acids with a calculated mol wt of 15 408, in vitro translation experiments and western blotting of human myometrial tissue homogenates consistently demonstrated an apparent mol wt of approximately 28 000; reasons for this are discussed in detail with supporting evidence in Bailey et al.(2002). Of particular interest was the fact that western blot profiling of the ATF2 and ATF2-sm species in pregnant non-labouring myometrium, sampled from the upper and lower uterine segments (as detailed in Fig. 1aGo), indicated that both isoforms were spatially expressed within the body of the uterus; ATF2 is expressed only in the lower segment, whereas there exists a gradient of expression of the ATF2-sm protein with the highest level in the upper segment. This may correlate with the known contractile and relaxatory properties of these uterine regions at term and at the onset of parturition. Although no definite exonic structure of the ATF2 gene has been reported, a predicted model has been proposed (Ensembl gene ID ENSG00000115966, Fig. 1bGo) comprising 12 exons and five functional domains, including a proline-rich domain (involved in protein–protein interaction), two glutamine-rich domains (involved in transcriptional trans-activation), a HAT domain and a bZIP domain involved in CRE-binding. Despite comprising only the first two and last two putative exons, and being devoid of most exons coding for functional domains, the novel ATF2-sm protein was found to possess CRE-binding activity and to trans-activate CRE-directed transcription of a reporter gene in myometrial and COS-7 cells to an equivalent degree to that of the full-length ATF2. To further characterize the roles of ATF2 and ATF2-sm in regulating myometrial gene expression during foetal maturation and parturition, we have stably transfected myometrial cell lines with plasmid constructs expressing the individual proteins, and made use of microarray, suppression subtractive hybridization (SSH) and semi-quantitative/real time RT-PCR experiments to identify downstream target genes that may be under their transcriptional control.



View larger version (42K):
[in this window]
[in a new window]
 
Figure 1 (a) Spatial expression of the ATF2 and ATF2-sm transcription factors in the human myometrium during pregnancy. Western blotting of myometrial tissue extracts with an anti-ATF2 antibody revealed a post-conception switch from uniform expression to spatially differential expression of these factors. The full-length ATF2 protein was found to be present in a gradient from the lower uterine segment to the fundus; the novel ATF2-sm splice-variant, in contrast, was present in a gradient from the fundus to the lower segment. (b) Predicted functional domains of the ATF2 and ATF2-sm proteins, indicated by shading. P, proline-rich domain; Q, glutamine-rich domains involved in trans-activation; HAT, histone acetyl-transferase domain; bZIP, basic-region leucine-zipper domain.

 

    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Human myometrial tissue collection

Human myometrial tissue biopsies were collected from pregnant non-labouring (P) women at elective caesarean section and from non-pregnant (NP) pre-menopausal women (ages 32–46 yr) during hysterectomies performed for benign gynaecological disorders such as menorrhagia or dysmenorrhoea. NP tissue samples were taken from the middle of the uterine wall, about 5–10 mm away from the endometrial or serosal surfaces: upper segment samples were taken from the corpus and lower segment samples were taken from close to the cervix, although it is generally realised that the lower uterine segment is poorly defined in the NP state. P samples were taken using laparoscopic biopsy forceps from the side of the uterus opposite the placental bed to minimize the inclusion of deciduas, again from the corpus (upper segment) and close to the cervix (lower segment). These myometrial samples were then snap frozen in liquid nitrogen and stored at –70 °C. Written consent was obtained from all women and ethics approval for the study was granted by the Newcastle and North Tyneside Health Authority Ethics Committee.

Establishment of stable myometrial cell lines

Primary cultures of human myometrial cells were initiated by treating small pieces of P myometrium with collagenase solution (1 mg/ml collagenase, 0.02 mg/ml DNase, 0.2 mg/ml trypsin inhibitor, elastase and BSA fraction V, in Hank’s balanced salt solution free of Ca+ and Mg2+ ions). Samples were incubated with gentle shaking for 4 h, then transferred to a new tube to which 5 ml complete medium plus 10% FCS had been added. After centrifugation at 1000 g for 10 min, the supernatant was decanted and discarded, the cells were resuspended in 15 ml of fresh complete medium plus 10% FCS and cells were then seeded into flasks. After incubation at 37 °C for 1 h to allow fibroblast attachment, the medium, now containing primarily myometrial cells with few contaminating fibroblasts, was transferred to new flasks and incubated for 24 h at 37 °C. The growth medium was then replaced to inhibit fibroblast growth, with MEM D-Valine medium (Gibco) plus 10% FCS, containing 50 U/ml of penicillin and 50 µg/ml of streptomycin. Growth medium was replaced with fresh medium every 2–3 days, and after reaching confluence, cells were subcultured at a ratio of 1:3.

ATF2 and ATF2-sm full length plasmids were cloned as described by (Bailey et al. (2002). Transfections were performed upon low passage number (2 or 3) myometrial cells at 70% confluence using 4 µl Mirus TransIT-LT1 lipid-based transfection reagent (Cambridge Bioscience, Cambridge, UK) per 1 µg plasmid. Typically, 6 µg plasmid was used per transfection, mixed with 24 µl LT-1 reagent and 200 µl serum-free medium and incubated at room temperature (RT) for 5 min. This complex was added to the cells and incubated at 37 °C for 4 h, after which time it was removed and fresh medium (+ serum) added. Incubation at 37 °C was continued for 48 h, after which time the selective agent G418 was added to a final concentration of 80 µg/ml. The final concentration of G418 was increased to 250 µg/ml for subsequent selection and maintenance of isolated stably-transfected colonies. Transfection efficiencies were consistently above 80%.

Cell staining/immunocytochemistry

Cultured myometrial cells were stained to allow morphological examination using haematoxylin and eosin stains. Cells grown on cover-slips were rinsed with 1x PBS, fixed in cold methanol for 10 min, washed with water and then exposed to haematoxylin for 1 min. Following a quick water wash, cells were exposed to Scott’s water (0.04 M NaCO3, 0.08 M MgSO4) for 1 min. Another water wash was performed, then the cells were incubated in eosin stain for 2 min. After a final brief wash in water, the slips were allowed to dry and mounted in DPX resin on microscope slides for viewing.

To determine the level of fibroblast contamination in the smooth-muscle cell cultures, immunocytochemistry was performed using Fibroblast Antigen (Ab-1; Oncogene Research Products, CA, USA) (Saalbach et al. 1997) and the DAKO ChemMate APAAP detection kit with a Vector Blue Alkaline Phosphatase Substrate Kit III (Vector Laboratories, CA, USA). Cells were cultured on cover-slips and fixed as above, then incubated in normal rabbit serum for 10 min. After a brief rinse with TBS, cells were incubated in Ab-1 primary antibody for 1 h at a 50µl/ml dilution (10µg/ml final concentration) at room temperature. After three 5 min rinses in 1xTBS, cells were exposed to the secondary-link antibody for 45 min. Following three more 5 min rinses in 1xTBS, the cells were incubated in APAAP for 20 min, followed by another round of washing in 1xTBS. One drop of the Levamisole chromagen was then added to the cells, and colour development was monitored microscopically. Chromagenesis was halted by rinsing with water.

RNA isolation

Total RNA was isolated from approximately 1x107 cells using TRI-Reagent (Sigma-Aldrich) according to the manufacturer’s protocol. The resulting pellet was resuspended in 100 µl RNase-free H2O and incubated at 55 °C for 10 min to aid this process. This total RNA was then applied to an RNeasy mini-column (Qiagen), and subjected to RNase-free DNase treatment using the RNase-free DNase set (Qiagen). The remainder of the manufacturer’s protocol was then followed for RNA cleanup, eluting with 25 µl of RNase-free H2O. Total RNA was quantified by spectrophotometry and used for microarray analysis or SSH.

Confirmation of ATF2/ATF2-sm expression levels in stably-transfected cell lines

Levels of ATF2/ATF2-sm expression in stably transfected cell lines were examined and compared with one another by sqRT-PCR using the Superscript one-step RT-PCR system (Invitrogen) in a total volume of 25 µl with 5% (v/v) RNaseOUT (Invitrogen) RNase inhibitor, and 100 ng total RNA template prepared as described above. Primers were as described previously by Bailey et al.(2002), and reaction conditions as follows: reverse transcription step=50 °C for 30 min, 94 °C for 2 min. Amplification step=30 cycles of (94 °C 15 s, 50 °C 30 s, 68 °C 1 min), followed by 68 °C for 9 min. 5 µl of each reaction was subjected to agarose gel electrophoresis and RNA samples from those colonies displaying the highest ATF2/ATF2-sm expression were selected for microarray analysis and SSH.

Affymetrix microarray analysis

Experimental design, execution, and subsequent data analysis were all carried out according to the guidelines of the Minimum Information About a Microarray Experiment (MIAME) document, developed by the Microarray Gene Expression Data Society (http://www.mged.org/miame) (Brazma et al. 2001).

Target preparation

A total of 10 µg RNA was used for each target. Each sample was used as a basis to synthesize double-stranded cDNA, which in turn was used to synthesize biotin-labelled cRNA for hybridization to the microarray chips. The Affymetrix protocol was followed, and the steps are summarized briefly here:

cDNA synthesis
First-strand cDNA synthesis was achieved using the SuperScript Choice system (Invitrogen) and the Gene-Chip T7-Oligo(dT) primer at 42 °C for 1 h. Second strand cDNA was synthesized from this using E.coli DNA ligase, polymerase I and RNase H at 16 °C for 2 h.

Synthesis of biotin-labelled cRNA
This was performed according to the protocol, using the Affymetrix Enzo BioArray High Yield RNA Transcript Labelling Kit (Affymetrix, High Wycombe, Herts, UK); 20 µg of this labelled and purified cRNA was then fragmented (according to the protocol) prior to the hybridization step.

Hybridization
The hybridization cocktail was prepared according to the Affymetrix instructions, and incubated with the array at 45 °C for 16 h in rotisserie oven at 60 r.p.m.

Washing, staining and scanning
Washing and staining was performed in the Affymetrix Fluidics Station 400 according to the standard format of the single stain protocol for eukaryotic targets.

Data analysis
Data from the chip hybridizations was processed using the Affymetrix microarray suite 4.0 software. Human 133 A microarray chips were hybridized with biotin-labelled cRNA from the following myometrial cell-lines: (i) Control non-transfected primary cultures (Ctrl); two replicates (ii) Control cells stably-transfected with empty vector with no insert downstream of a CMV promoter (CMV–); three replicates (iii) Cells stably-transfected with a plasmid to express ATF2 (ATF2); three replicates (iv) Cells stably-transfected with a plasmid to express ATF2-sm (ATF2-sm); three replicates. Raw data files direct from the Affymetrix chip scanner were imported into the GeneSpring program (Silicon Genetics)) for each chip. These data sets were transformed by converting all signal values below 0.01 to 0.01, then subjected to per chip normalization to the 50th percentile and per gene normalization to the median. To determine a baseline profile of gene expression with which to compare the ATF2 and ATF2-sm results, an initial comparison was made between cell-lines (i) and (ii), using data from the primary non-transfected cells as a baseline and data from the CMV– empty vector transfected cells as the experimental set. This established which genes were affected by the stable transfection of the vector, and which therefore should be excluded from the main analyses involving the ATF2 constructs. According to related literature (Mayanil et al. 2001, Gibellini et al. 2002), an appropriate cut-off point for this purpose is in the region of greater than or equal to a 1.5—2-fold change in expression; 1.5 was used in our analysis. The remaining data set following this exclusion was then used as a baseline for comparisons with ATF2 and ATF2-sm expression. This was achieved by performing a parametric one-way analysis of variance (ANOVA) on the normalized data assuming equal variances, incorporating the Benjamini and Hochberg False Discovery Rate multiple testing correction (Hochberg & Benjamini 1990) set at a rate of 0.05. The resultant list of genes differentially expressed between the two control classes was then filtered to include only those genes showing a fold change in expression of 1.5 or greater. These genes were then subtracted from the list of genes represented on the Affymetrix Human 133 A chip (22 283), resulting in the elimination of genes whose expression was altered by the process of stable transfection and selection. The remaining data set following this exclusion was then used as a final baseline for comparisons with ATF2/ATF2-sm expression. These comparisons involved much the same process; data was normalized as above, then compared with gene expression levels in the final baseline by ANOVA using the same criteria. The results were then filtered to include only those genes whose expression altered by a fold change of two or greater.

SSH and differential screening

SSH was performed according to the published protocols using the PCR-Select cDNA subtraction kit and PCR-Select differential screening kit (BD Biosciences Clontech, Oxford, UK). Briefly, mRNA was isolated from the stably-transfected ATF2-sm cell-line using the Poly(A)Pure mRNA Isolation Kit (Ambion Europe Ltd., Huntingdon, Cambs, UK) 2 µg was used to synthesize ds-cDNA. Following RsaI digestion and ligation of adaptors to tester cDNA, two rounds of hybridization were performed with excess driver cDNA to subtract non-differentially expressed molecules, then two rounds of adaptor-directed suppression PCR to selectively amplify the cDNAs representing differentially expressed genes. These products were then cloned into the pCR4-TOPO vector (Invitrogen) to form a subtracted cDNA library, and subtracted and unsubtracted probes were synthesized from these PCR products for use in the library screening procedure. Briefly, transformed bacterial colonies from the library construction step were picked, and grown overnight in 96-well plates in LB AP+ medium. 1 µl of each culture was then used as a template for adaptor-directed PCR amplification of the plasmid inserts, of which 5 µl was spotted onto a Hybond N membrane. Four replicate membranes were produced for probing with forward subtracted, reverse subtracted, unsubtracted tester and unsubtracted driver probes. These probes were synthesized by random primer labelling of 75 ng of the appropriate cDNA, and hybridized to the membranes in sealed trays with shaking at 72 °C after pre-hybridizing with PerfectHyb Plus buffer (Sigma-Aldrich) containing 0.2x SSC and 50 µl blocking solution (10 mg/ml sheared salmon sperm DNA, 0.3 mg/ml oligonucleotides corresponding to nested primers and complementary sequences). After washing and drying, the membranes were subjected to autoradiography. Clones representing differentially expressed genes were identified according to the combination of hybridization results for the four different probes summarized in the PCR-Select differential screening kit protocol, and identified by DNA sequencing.

Semi-Quantitative RT-PCR (SQ RT-PCR)

In order to support the results obtained from the microarray and SSH experiments, a selection of candidate genes were examined for differential expression as a result of the over-expression of ATF2 and/or ATF2-sm by sqRT-PCR. The primers used for this were as follows, where F=forward primer, R=reverse primer. GAPDH: F=CTGCCGTCTAGAAAAACC, R=CCA CCTTCGTTGTCATACC; MTATP6: F=TGTTCG CTTCATTCATTGCC, R=ATGTGTTGTCGTGCA GGTAGA; CYB: F=CCCAATACGCAAAATTAA CCC, R=CGGATGCTACTTGTCCAATGA; HTM{alpha}: F=ATGGACGCCATCAAGAAGAA, R=GAAAATG TCCTACAATGTGCA; CDH2: F=GCCTCCATGT GCCGGATA, R=TCTCGGTCCAAAACAGCAAT; ZNF297b: F=AAGGCACAGGCTGAATCTGTT, R=TCTGTGCCCAGATTTGCATT; LIM: F=GAG TCACTTGTCAGCCCTTGT, R=ACATTGTTCC GAATGGGCTT; TES: F=ATTGATGGGCTTA GGTCACGA, R=TGAGGGGGAAAAAAGAAGTG; RPL15: F=TAAGCCAAGATGGGTGCATA, R= CAAATTGACCCTGGACAACA; GPR63: F=CGC TGCCCTTCGCTTGA, R=GCAGTATCAGGTCC CATTGATG; GNA15: F=CGGGCCTACTATGAG CGTC, R=ACGTAGCCCTCCTCGGTGAT; GAS1: F=CCGCCGCCTCATCTGCT, R=GCCTCGGCG TACTGGTTG; MAP7: F=CGGCTCTCCTCT TCATCTGC, R=GAACGAATGTGTGGGCGTC; HSP70B': F=TTCGACAACCGGCTCGTG, R=TTG TTCCCGCTCAGGTCCTT; KIF20: F=GACAGG AAGATCAGGGTTGTGTC, R=CAAAAGAGTCCT TGGGTGCTT; CALCRL: F=TGAGGACTCAATT CAGTTGGGAGT, R=CCATCCATCCCAGGTTC TGTTG and GAB2: F=ACAGCCGACTTCACCG AGCTTC, R=CAGACCGGCCTGCACTCTCT

sqRT-PCR was performed using the SuperScript OneStep RT-PCR system. 50 ng DNase-treated total RNA from stably-transfected cells, or 5 ng mRNA from pooled non-pregnant myometrial tissue or pregnant non-labouring myometrial tissue was used as template according to the manufacturer’s protocol, and a total of 28, 30 and 32 cycles of PCR were performed at an appropriate annealing temperature for each particular primer pair to ascertain the best quantitative signal for each target sequence following agarose gel electrophoresis (2% E-gels, Invitrogen) of the products. Image analysis and band intensities were analyzed with the Intelligent Quantifier program (Bio Image Systems Inc., Jackson, MI, USA).

Real-time RT-PCR analysis

Forward primers were designed using LUX primer design software (www.invitrogen.com) and were as follows. ATF2: GNA15=5'-GACGCCGGGCCTGC TATGACCGC-3' and ATF2-sm: HSP70B'=5'-CACGATTCGACAACCGGCTCGG-3'. Reverse non-LUX labelled primers were as above for SQ RT-PCR. Reactions were performed using the SuperScript III Platinum One-Step Quantitative RT-PCR System (Invitrogen). Reactions were set up in 25 µl volumes according to the manufacturer’s protocol, and cycled as follows: 50 °C for 15 s: 95 °C for 2 s: then 45 cycles of 95 °C for 15 s and 60 °C for 30 s. Commercially available LUX primers (Invitrogen) were used to amplify GAPDH as a reference gene. Melting curve analysis was performed to ensure reaction specificity, and relative quantitation was determined by standard curve analysis.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Stable transfection and microarray data

Following the stable transfection and selection process, cell-lines were examined to verify that (a) they were predominantly composed of myometrial smooth-muscle cells and that fibroblast contamination had been successfully kept to a minimum, and (b) that the cells had not been in any way damaged, i.e. were in a healthy state with no gross morphological changes. Figure 2a and bGo shows the results of these examinations following the appropriate cell-staining procedures, indicating not only low-level or zero presence of fibroblasts in the cultures (less than 1%), but also a ‘normal’ morphology in the stably-transfected cell-lines when compared with the non-transfected control.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 2 (a) Immunocytostaining of human myometrial and fibroblast cultured cells using anti-fibroblast specific antigen (Ab-1) mAb ASO2 (oncogene). (i) Note intense anti-ASO2 reactivity with fibroblast cells, in contrast to the light staining with myometrial cells in (ii). Negative controls, omitting the primary ASO2 mAb, are shown in (iii) and (iv) for fibroblast and myometrial cells, respectively. (b) Haematoxylin and eosin (H&E) staining of stably-transfected myometrial cells expressing (i) ATF2 and (ii) ATF2-sm. Morphology was compared with control non-transfected (iii) and empty-vector stably-transfected (iv) cells, and showed no difference. (c) RT-PCR analysis of isolated stably-transfected colonies to determine abundance of ATF2 and ATF2-sm mRNAs. Total RNA was isolated from these cell lines, and used as a template for RT-PCR of the ATF2 and ATF2-sm isoforms. Expression levels were compared with control non-transfected (–) and empty-vector stably-transfected (C) cells. Those with the highest degrees of ATF2 and ATF2-sm expression (*) were used for SSH analysis and as the three replicate RNA populations for the microarray analysis.

 
Agarose gel electrophoresis of ATF2 and ATF2-sm RT-PCR products from stably transfected cell lines revealed a wide range of expression levels between isolated clones (Fig. 2cGo). Total RNA was isolated and purified from those colonies showing the highest levels of expression, and amplified and labelled prior to microarray hybridization and analysis or SSH according to the methods described below. Chip Sequence file results produced by the array scanner have been submitted to the NCBI gene expression and hybridization array data repository (GEO) (The microarray data derived from chip sequence files for all hybridizations, including the cell-only control, two replicates of the empty-vector control and three replicates of each of the ATF2 and ATF2-sm experimental samples, have been submitted to the NCBI GEO (http://www.ncbi.nlm.nih.gov/geo/), under GEO numbers GSM17039 [NCBI GEO] , GSM17040 [NCBI GEO] , GSM 17041, GSM 17067, GSM 17068, GSM 17069, GSM 17070, GSM 17071 and GSM 17072). Following hybridization and scanning, chip data was imported into GeneSpring software for normalization and manipulation. A ‘final baseline’ of gene expression in cultured myometrial cells with which to compare the experimental data from the stably transfected cells was obtained as described in Materials and methods, and indicated that the expression of a total of 1317 genes (5.9% of the total) was affected significantly (greater than or equal to 1.5-fold) by the transfection and selection process, of which 879 were up-regulated and 438 down-regulated. These genes were subtracted from the 22 283 genes represented on the microarray chip, to give a final baseline of 20 966 genes. All subsequent analyses of gene expression in the stably-transfected cell lines included data for these genes only, and the mean levels of expression in this final baseline were used as the basis for these comparisons, the outcome of which is summarized in Table 1Go, and presented in Fig. 3a and bGo for ATF2 and ATF2-sm respectively.


View this table:
[in this window]
[in a new window]
 
Table 1 Number of genes affected by stable expression of ATF2 and ATF2-sm in cultured myometrial cells according to data from Affymetrix Human 133 A microarray chips 5
 



View larger version (107K):
[in this window]
[in a new window]
 
Figure 3 (a) Total RNA samples were isolated from stably-transfected cell-lines expressing the ATF2 gene, and hybridized to Affymetrix Human 133 A microarray chips as described in Materials and methods. Following scanning and data analysis, those genes found to be up- or down-regulated by 2-fold or greater in comparison to baseline expression were classified according to their function by GeneSpring software, and are listed here. (b) Total RNA samples were isolated from stably-transfected cell-lines expressing the ATF2-sm isoform, and hybridized to Affymetrix Human 133 A microarray chips as described in Materials and methods. Following scanning and data analysis, those genes found to be up- or down-regulated by 2-fold or greater in comparison to baseline expression were classified according to their function by GeneSpring software, and are listed here.

 
Over-expression of the ATF2 gene in cultured human myometrial cells by stable transfection gave rise to a total of 204 downstream genes whose expression was altered by a factor of two or more (0.97% of genes represented on the chip), 113 of which showed increased expression and 91 of which showed a decrease. Similar experiments with ATF2-sm over-expression altered the abundance of 55 mRNA species (0.26%), 29 of which were up-regulated and 26 down-regulated.

From the total of 259 genes found to be significantly altered as a result of the expression of either ATF2 factor, only two were affected by both: transient receptor potential cation channel, subfamily C, member 4 (TRPC4) which was up-regulated by both isoforms, and calcitonin receptor like (CALCRL) which was down-regulated by both. The genes in all lists were classified and grouped according to their functions as determined by the GeneSpring software; where genes belonged to more than one functional group, the results tables were manually trimmed to prevent multiple entries of these particular genes. Many of these genes are described in detail in the discussion section.

SSH of ATF2-sm stably transfected myometrial cells

Dot-blot screening of 100 transformed bacterial colonies resulting from this procedure gave rise to 25 putative differentially expressed clones, as determined from the blot patterns with probes derived from (i) forward subtracted, (ii) reverse subtracted, (iii) unsubtracted driver and (iv) unsubtracted tester cDNAs (Fig. 4Go). These genes were identified by sequencing of the clones represented by the colonies on the dot-blots, and are listed in Table 2Go.



View larger version (138K):
[in this window]
[in a new window]
 
Figure 4 SSH results revealed differentially expressed genes in ATF2-sm stably transfected cells. Briefly, libraries of putative differentially expressed genes were constructed following the subtraction procedure, and transformed into bacterial cells for amplification. The inserts in the library plasmids were then amplified from these bacterial cultures by PCR, and spotted onto membranes for screening with forward subtracted, reverse subtracted, unsubtracted driver and unsubtracted tester probes. Examples of the resultant blots are shown here. The likelihood of differential expression of any particular clone was indicated by the pattern and intensity of the signals from the four blots; three instances are shown here, where {19arrow1}=probably differentially expressed; {19arrow2}=probably differentially expressed if intensity difference between forward subtraction and others is high; {19arrow3}=not differentially expressed. Boxed area=negative controls.

 

View this table:
[in this window]
[in a new window]
 
Table 2 Putative differentially expressed genes in ATF2-sm stably-transfected myometrial cells, as revealed by SSH
 
Semi-quantitative and realtime RT-PCR

The validity of the results from the microarray and SSH experiments was examined by performing a panel of semi-quantitative RT-PCR reactions. Four randomly-selected genes were chosen from the results of the ATF2 and ATF2-sm microarray experiments for each factor and, by semi-quantitative RT-PCR, their mRNA levels assessed in control cultured myometrial cells containing empty vector, the stably-transfected myometrial cell-line used for the array hybridization, pooled non-pregnant (NP) tissue and pooled pregnant non-labouring (P) tissue (n=6; Fig. 5Go). In each case, the level of expression in stably-transfected cells compared with control cells reflected the results from the microarrays: those genes found to be up- or down-regulated by expression of ATF2 and ATF2-sm by microarray analysis also showed increased or decreased expression respectively in the stable cell-lines compared with control cells by RT-PCR. In addition, the expression of these genes was found to be significantly altered between the pooled NP and P tissue, reflecting the in vivo biological situation. Of the eight genes examined, four were expressed at a higher level in NP tissue and four at a higher level in P tissue. Real-time RT-PCR analysis of two of these genes, GNA15 and HSP70B', also indicated significant up-regulation of their expression in stable cell-lines in concordance with the microarray data, and also increased expression in NP tissue compared with P tissue reflecting the in vivo situation.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5 Semi-quantitative and quantitative RT-PCR was performed to verify differential expression of a random selection of genes revealed in the microarray analyses. Comparisons were made between (a) total RNA templates isolated from control empty vector stably-transfected cell lines and cell lines stably transfected with ATF2 and ATF2-sm constructs, and (b) mRNA templates isolated from pooled (n=6) NP and P myometrial tissue samples. 5 ng of mRNA or 50 ng of total RNA was used as template in RT-PCR reactions using the SuperScript OneStep RT-PCR system (Invitrogen) for 28, 30 and 32 PCR cycles, and the linear-range products were analyzed by 2% agarose gel electrophoresis, as shown above. In each case, the level of expression in stably-transfected cells compared with control cells reflected the results from the microarrays: those genes found to be up- or down-regulated by expression of ATF2 and ATF2-sm by microarray analysis also showed increased or decreased expression, respectively, in the stable cell-lines compared with control cells by RT-PCR. In addition, the expression of these genes was found to be significantly altered between the pooled NP and P tissue, reflecting the in vivo biological situation. Of the eight genes examined, four were expressed at a higher level in NP tissue and four at a higher level in P tissue. Real-time RT-PCR analysis of two of these genes, GNA15 and HSP70B', also indicated significant up-regulation of their expression in stable cell-lines in concordance with the microarray data, and also increased expression in NP tissue compared with P tissue reflecting the in vivo situation.

 
Confirmation of differential expression in vivo of eight randomly selected genes from the SSH results was obtained by semi-quantitative RT-PCR using total RNA isolated from pooled (n=6) NP and P myometrial tissue samples (see Materials and methods); representative products are shown in Fig. 6Go. Of the eight genes tested, all were found to be at a higher level in NP tissue when compared with P, possibly reflecting the in vivo condition.



View larger version (52K):
[in this window]
[in a new window]
 
Figure 6 Semi-quantitative RT-PCRs of selected differentially expressed candidate genes from the SSH screen of ATF2-sm stably-transfected cells. One-tube RT-PCR was performed using total RNA isolated from NP and P lower segment myometrial tissue samples as template, using 28, 30 and 32 PCR cycles to obtain a representative band from the linear amplification range after agarose gel electrophoresis. Bands were visualized using a gel documentation system at equivalent integrations, and scans of these are shown above. In each case, candidate positive genes from the SSH screen, i.e. those up-regulated in ATF2-sm stably-transfected cells, were found to be more highly expressed in the NP myometrium.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Using microarray analysis, SSH techniques, and semi-quantitative/realtime RT-PCR, comparing gene expression in cultured human myometrial cells stably transfected with expression constructs of ATF2 proteins with similar, empty-vector transfected control cell lines and pooled non-pregnant and pregnant myometrial tissue, we have identified a significant number of genes that are regulated by the ATF2 and novel ATF2-sm transcription factors. The expression of 204 genes was altered by the full-length ATF2 isoform, representing just under 1% of the genes represented on the microarray chip; the recently identified and apparently novel ATF2-sm isoform, encoded by the first two and last two putative exons of the 12-exon ATF2 gene, altered the expression of 55 downstream target genes corresponding to 0.26% of genes on the chip. Screening of an SSH library identified a further set of 25 genes regulated by ATF2-sm.

The results revealed a diverse range of gene categories in terms of biological processes, cellular components and molecular functions that are regulated by these bZIP factors. A small selection of these genes is detailed here, in terms of their patterns of expression in the presence of the ATF2 bZIP transcription factors and how these relate to myometrial function during gestation and labour.

TNFR9 was observed to be up-regulated by ATF2. Genes from the tumour necrosis factor receptor superfamily (TNFR) have significant roles in the myometrium due to the importance of TNF{alpha} in gestation; this is expressed by myometrial stromal cells during pregnancy, although the major source in the myometrium is thought to be macrophages and other leukocytes (Yelavarthi et al. 1991, Tabibzadeh et al. 1994, Young et al. 2002). It stimulates the production of arachadonic acid and prostaglandins (in particular the stimulatory PGF1{alpha}) (Pollard & Mitchell 1996a, b, Hertelendy et al. 2002); up-regulates matrix metalloproteinase-9 (MMP-9), which is involved in tissue remodelling of the myometrium during labour (Roh et al. 2000); increases adenylyl cyclase (AC) activity in myometrial cells (Gogarten et al. 2003); and may prepare the myometrium for labour by regulating the cyclic-ADP–ribose-signalling (cADPR) pathway which controls the development of intracellular Ca2+ transients (Barata et al. 2004).

ATF2-sm increased the expression of the heat shock 70 kDa protein (HSPA6/HSP70B'); heat shock proteins form associations with steroid receptors, including those for oestrogen and progesterone, and modulate their functions (Komatsu et al. 1997). HSPs 70 and 90 have been shown to increase dramatically during labour in the ovine myometrium, and possibly inhibit progester-one receptors and activate oestrogen receptors (Wu et al. 1996).

In the signal transduction/integrin receptor signalling class, ATF2 caused an increase in expression of the calcium channel, voltage dependent, P/Q type, alpha 1A subunit (CACNA1A), and a decrease in the expression of the regulator of G-protein signalling 14 (RGS14). With regard to CACNA1A, the importance of the regulation of calcium homeostasis in the myometrium and its relation to uterine contractility is self-evident. RGS proteins interact with the G{alpha}q and G{alpha}i proteins to accelerate GTPase activity and RGS2, for example, is known to increase in cultured human myometrial cells in response to oxytocin via an increase in intracellular Ca2+ concentration, and also increases during pregnancy and decreases just prior to labour in rat myometrium in response to progesterone levels (Park et al. 2002, Suarez et al. 2003).

The expression of various integrins and cadherins are known to alter in the human uterus during pregnancy (Brackin et al. 2002, Charpigny et al. 2003); for example, ICAM-1 has been found to be up-regulated in the myometrium 10.5-fold during labour (Ledingham et al. 2001), and E-selectin (SELE; endothelial adhesion molecule 1) has been shown to increase during labour (Thomson et al. 1999). In this respect ATF2-sm down-regulated expression of integrin {alpha}3 (ITGA3).

Among the other functional classes of genes affected by ATF2 and ATF2-sm over-expression were the following: gonadotropin inducible transcription repressor-3 (GIOT-3) was down-regulated by ATF2, which may lead to an increase in its expression in the transition from the non-pregnant to the pregnant state as ATF2 expression decreases. This could also be augmented by the increase in myometrial hCG levels during pregnancy. The gene expression of four collagen types was altered by ATF2; XIII{alpha}1 and IV{alpha}3 were increased, whereas VI{alpha}1 and XVII{alpha}1 were decreased. Collagen is important in the fibrillar network of the uterus, where it provides mechanical support for its structural components and a favourable milieu for their activities (Goranova et al. 1993). Fibrils have been shown to reorganize in response to the hormonal changes that take place during pregnancy, and also to be degraded by myofibroblastic interstitial cells in preparation for the labouring and postpartum stages to allow the development of elastic fibres and basement membranes (Nishinaka & Fukuda 1991). Three forms of collagen type VI (one of which was down-regulated by ATF2 here) have been shown to be present at high levels in murine myometrium during pregnancy (Dziadek et al. 1995). In addition, ATF2 caused a decrease in the expression of the MMP-20. The expression of MMPs in the myometrium is regulated by TGF-ß1 (Ma & Chegini 1999), and is absolutely dependent on the presence of serotonin, which is induced by IL-1{alpha} (Dumin et al. 1998).

Protein kinase C (PKC), involved in the mediation of endothelin-induced uterine contractions (Oriji & Keiser 1996) and the regulation of oxytocin-mediated myometrial contractions (Phillippe 1994), is of critical importance in the myometrium. It acts to promote a contractile state by reducing the activity of adenylyl cyclase and therefore cAMP accumulation (Grammatopoulos et al. 1996, Grammatopoulos & Hillhouse 1999), and by reducing guanylyl cyclase activity and therefore cGMP accumulation, to neutralize relaxatory pathways. ATF2, however, caused a decrease in expression of the {tau} (iota) isoform; this may be involved in cytokine-induced NF-kappa B activation (Anthonsen et al. 2001).

G protein coupled receptors (GPCRs) comprise the largest family of receptors in the uterus; they can be stimulatory or inhibitory, and their interaction with heterotrimeric GTP-binding proteins enables them to induce the hydrolyzation of GTP and to modulate the activity of a wide variety of enzymes and ion channels that affect uterine contractility. Some GPCRs are coupled to phospholipase C, which generates the second messengers inositol 1,4,5-trisphosphate (IP3) and diacyl-glycerol. These act to stimulate contractions via the mobilization of calcium in the sarcoplasmic reticulum in the case of IP3, and in the case of diacylglycerol to activate PKC and the MAPK cascades (Bernal 2003). Other GPCRs are coupled to adenylyl cyclase, which promotes the accumulation of cAMP which acts to promote uterine relaxation via the inactivation of myosin light-chain kinase (MLCK) and the action of the cAMP-dependent bZIP transcription factors. In addition, uterine contractility can also be enhanced via the activation of Rho GTPases, and the subsequent action of Rho kinases to potentiate the effect of MLCK (Moore et al. 2000, Moran et al. 2002). GPCR63 was up-regulated by ATF2.

S100 calcium-binding protein A13 (S100A13) has been shown to mediate the stress-induced release of IL-1{alpha} (Mandinova et al. 2003); this interleukin induces the expression of serotonin in the uterus, which in turn allows the expression of MMPs in myometrial cells (Dumin et al. 1998). The importance of collagen and MMPs in the uterus has already been discussed; S100A13 was up-regulated by ATF2.

The gene for caveolin 2 (CAV2) was up-regulated by ATF2; caveolin expression in the myometrium of the pregnant rat is known to be suppressed in the first half of pregnancy, after which it increases up to delivery, increasing the number of caveolae present in myometrial cells (Turi et al. 2001). This has been shown to be dependent upon levels of oestrogen and progesterone.

There is mounting evidence that cytokines are critically important in the modulation of uterine activity and that the regulation of parturition is, to a large degree, an inflammatory process. A rise in proinflammatory cytokines and the infiltration of leukocytes into the uterine tissues at labour are well documented. They are known to be largely derived from the placenta and extra-placental membranes (gestational tissues) (Bowen et al. 2002), although the cytokine-inducible expression of interleukins in uterine smooth muscle cells suggests that the myometrium itself may be a significant contributor of inflammatory mediators (Helmer et al. 2002). The chemokine (C-C motif) receptor 4 (CCR4) was up-regulated by ATF2.

Endothelin receptors were affected by ATF2; receptor type A, which is preferentially expressed in the upper segment of the uterus and thought to exert a stimulatory effect with regard to contractility, was found to be down-regulated.

Any variance in the expression of oestrogen receptors will, taking into account the importance of the hormone and its wide ranging effects upon other factors involved in the control of uterine gene expression and contractility, exert promiscuous and far reaching effects. It is therefore interesting to note the increased expression of oestrogen receptor 2 (ESR2/ESR-beta) with over-expression of ATF2, and to compare this to the detected increase in expression of the alternative oestrogen receptor 1 (ESR1/ESR-alpha) associated with over-expression of the ATF2-related bZIP transcription factor CREB in myometrial cells (Bailey et al. 2004), which has been found to be prevalent in the non-pregnant myometrium but almost absent in pregnant non-labouring and spontaneous labouring tissue (Bailey et al. 2000). Interestingly, a significant minority of genes found to be affected by the over-expression of ATF2 and ATF2-sm in myometrial cells in this study are also affected by CREB (Bailey et al. 2004): 25% of the genes affected by ATF2, and 38% of the genes affected by ATF2-sm.

An overlap also exists between the groups of genes affected by ATF2 and ATF2-sm. This is represented in the form of a Venn diagram in Fig. 7Go. The number of genes commonly affected by the two ATF2 proteins amounts to only two, or just under 1% and just over 3% of genes affected by ATF2 and ATF2-sm respectively. However, these two genes may well be of great importance with regard to myometrial contractility; one, TRPC4 encodes a component of store-operated calcium entry (SOCE) channels that play an important role in myometrial calcium homeostasis (Dalrymple et al. 2002), and was up-regulated by both ATF2 isoforms. The other, CALCRL is related to the CGRP, which induces dose-dependent relaxation in spontaneously contracting myometrium from pregnant women, an effect that is diminished in myometrium obtained from patients during labour and in the non-pregnant states (Dong et al. 1999). This gene was down-regulated by both ATF2 isoforms.



View larger version (8K):
[in this window]
[in a new window]
 
Figure 7 The ATF2 and ATF2-sm factors regulate highly discrete groups of genes; only two were regulated by both proteins. However, these two genes may well be of great importance with regard to myometrial contractility; one, TRPC4, encodes a component of store-operated calcium entry (SOCE) channels that play an important role in myometrial calcium homeostasis, and was up-regulated by both ATF2 isoforms. The other, CALCRL, is related to the CGRP, which induces dose-dependent relaxation in spontaneously contracting myometrium from pregnant women, an effect that is diminished in myometrium obtained from patients during labour and in the non-pregnant states. This gene was down-regulated by both ATF2 isoforms.

 
Our previous results indicate that in vivo, at some point during pregnancy, expression of ATF2 is down-regulated in the myometrium whereas ATF2-sm becomes spatially expressed with greater levels detected in the fundus compared with the lower uterine segment (Bailey et al. 2000). These events may consequently have major effects on the genes observed to be regulated by these proteins in this study. It seems increasingly clear that the uterus can almost be regarded as two separate organs as term approaches, with the upper segment becoming highly contractile to exert downward pressure on the foetus at parturition, and the lower segment dilating to allow passage of the foetus through the birth canal. Plainly, such juxtaposing functions in the same organ must require global differences in gene expression, and the spatial expression of ATF2-sm in different regions of the uterus may have a role in this process. Regarding this spatial expression, a number of other genes have also been shown to be expressed spatially in the uterus; these include the oxytocin receptor (OTR) (Fuchs et al. 1984), connexin-43 and cyclo-oxygenase-2 (COX-2) (Sparey et al. 1999).

The spatio-temporal expression of ATF2 bZIP transcription factors raises the concern of their modes of action; not only are these factors responsive to different stimuli and activated by different pathways, but their dimerization codes bring into play several promoter elements in the downstream genes affected by them. Although the ATF2 and ATF2-sm proteins, in common with the related CREB/CREM factors, are substrates for PKA-mediated phosphorylation in vitro, the ATF2 proteins are insensitive to cAMP/PKA stimulation, and instead are a major target of MAPK cascades, upon which it depends for its activation. These MAPK cascades, which are instigated for example in response to the presence of inflammatory cytokines (well-characterized modulators of uterine gene expression), are classified into three subfamilies; the p38 cascade, the c-Jun amino-terminal protein kinase/stress-activated protein kinase (JNK/SAPK) cascade, and the extra-cellular signal-regulated protein kinase (ERK) cascade. All three of these cascades act in response to a variety of stresses to cause the phosphorylation and activation of ATF2 and increase its transcriptional activity, and the type of cascade involved is dependent upon the type of stimulatory factor (Hayakawa et al. 2003). The latter acts through the binding of mitogens or growth factors at the cell membrane, recruiting the Ras GTPase which activates the Raf Ser/Thr kinase. This in turn activates MAPK/ERK kinase (MEK) which phosphorylates and activates ERK1 and ERK2. These factors translocate to the nucleus where they activate a range of transcription factors that control cellular processes such as growth and differentiation, including ATF2. With regard to dimerization, ATF2 for example forms dimers with NF-{kappa}B and c-Jun; such dimers have greatly altered promoter motif binding properties (Wagner & Green 1994), and variable affinities to CRE contexts. ATF2:c-Jun heterodimers have a great affinity for AP1 sites compared with CREs, and the two constituent proteins may show either an antagonistic relationship to one another, or be present in certain tissues at inversely proportional levels. We have previously shown that the ATF2-sm protein also heterodimerizes with c-Jun in the myometrium, though the consequences of this are not presently known (Bailey et al. 2002).

In support of our hypothesis that ATF2/ATF2-sm proteins may play an important role involved in modulating myometrial gene expression and functionality, we have made an effort to link genes affected by these proteins to what is known of the in vivo physiology of the uterus during gestation and labour.


    Acknowledgements
 
This work was funded by a grant made available from the Wellcome Trust (grant 062928).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Abdel-Hafiz HA, Heasley LE, Kyriakis JM, Avruch J, Kroll DJ, Johnson GL & Hoeffler JP 1992 Activating transcription factor-2 DNA-binding activity is stimulated by phosphorylation catalyzed by p42 and p54 microtubule-associated protein kinases. Molecular Endocrinology 6 2079–2089.[Abstract/Free Full Text]

Anthonsen MW, Andersen S, Solhaug A & Johansen B 2001 Atypical lambda/iota PKC conveys 5-lipoxygenase/leukotriene B4-mediated cross-talk between phospholipase A2s regulating NF-kappa B activation in response to tumor necrosis factor-alpha and interleukin-1 beta. Journal of Biological Chemistry 276 35344–35351.[Abstract/Free Full Text]

Bailey J, Sparey C, Phillips RJ, Gilmore K, Robson SC, Dunlop W & Europe-Finner GN 2000 Expression of the cyclic AMP-dependent transcription factors, CREB, CREM and ATF2, in the human myometrium during pregnancy and labour. Molecular Human Reproduction 6 648–660.[Abstract/Free Full Text]

Bailey J, Phillips RJ, Pollard AJ, Gilmore K, Robson SC & Europe-Finner GN 2002 Characterization and functional analysis of cAMP response element modulator protein and activating transcription factor 2 (ATF2) isoforms in the human myometrium during pregnancy and labor: identification of a novel ATF2 species with potent transactivation properties. Journal of Clinical Endocrinology and Metabolism 87 1717–1728.[Abstract/Free Full Text]

Bailey J, Tyson-Capper (neé Pollard) A, Gilmore K, Robson SC & Europe-Finner GN 2004 Identification of human myometrial target genes of the CAMP pathway: the role of CAMP-response element binding (CREB) and modulator (CREM{alpha} and CREM {tau}2{alpha}) proteins. Journal of Molecular Endocrinology 34 1–17 (see this issue).

Barata H, Thompson M, Zielinska W, Han YS, Mantilla CB, Prakash YS, Feitoza S, Sieck G & Chini EN 2004 The role of cyclic-ADP-ribose-signaling pathway in oxytocin-induced Ca2+ transients in human myometrium cells. Endocrinology 145 881–889.[Abstract/Free Full Text]

Bernal AL 2003 Mechanisms of labour–biochemical aspects. British Journal of Obstetrics and Gynaecology 110 39–45.

Bowen JM, Chamley L, Keelan JA & Mitchell MD 2002 Cytokines of the placenta and extra-placental membranes: roles and regulation during human pregnancy and parturition. Placenta 23 257–273.[CrossRef][Web of Science][Medline]

Brackin MN, Cruse JM, Lewis RE, Hines RS, Stopple JA & Cowan BD 2002 Quantitative analysis of adhesion molecules on cellular constituents of the human uterine microenvironment under the influence of estrogen and progesterone. Experimental and Molecular Pathology 72 91–114.[CrossRef][Web of Science][Medline]

Brazma A, Hingamp P, Quackenbush J, Sherlock G, Spellman P, Stoeckert C, Aach J, Ansorge W, Ball CA, Causton HC, Gaasterland T, Glenisson P, Holstege FCP, Kim IF, Markowitz V, Matese JC, Parkinson H, Robinson A, Sarkans U, Schulze-Kremer S, Stewart J, Taylor R, Vilo J & Vingron M 2001 Minimum information about a microarray experiment (MIAME)—toward standards for microarray data. Nature Genetics 29 365–371.[CrossRef][Web of Science][Medline]

Chang L & Karin M 2001 Mammalian MAP kinase signalling cascades. Nature 410 37–40.[CrossRef][Medline]

Charpigny G, Leroy MJ, Breuiller-Fouche M, Tanfin Z, Mhaouty-Kodja S, Robin P, Leiber D, Cohen-Tannoudji J, Cabrol D, Barberis C & Germain G 2003 A functional genomic study to identify differential gene expression in the preterm and term human myometrium. Biology of Reproduction 68 2289–2296.[Abstract/Free Full Text]

Cho SG, Bhoumik A, Broday L, Ivanov V, Rosenstein B & Ronai Z 2001 TIP49b, a regulator of activating transcription factor 2 response to stress and DNA damage. Molecular and Cellular Biology 21 8398–8413.[Abstract/Free Full Text]

Dalrymple A, Slater DM, Beech D, Poston L & Tribe RM 2002 Molecular identification and localization of Trp homologues, putative calcium channels, in pregnant human uterus. Molecular Human Reproduction 8 946–951.[Abstract/Free Full Text]

Davis RJ 2000 Signal transduction by the JNK group of MAP kinases. Cell 103 239–252.[CrossRef][Web of Science][Medline]

Derijard B, Hibi M, Wu IH, Barrett T, Su B, Deng T, Karin M & Davis RJ 1994 JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76 1025–1037.[CrossRef][Web of Science][Medline]

Dong YL, Fang L, Kondapaka S, Gangula PR, Wimalawansa SJ & Yallampalli C 1999 Involvement of calcitonin gene-related peptide in the modulation of human myometrial contractility during pregnancy. Journal of Clinical Investigation 104 559–565.[Web of Science][Medline]

Dumin J, Wilcox BD, Otterness I, Melendez JA, Huang C & Jeffrey JJ 1998 Serotonin-mediated production of interstitial collagenase by uterine smooth muscle cells requires interleukin-1 alpha, but not interleukin-1 beta. Journal of Biological Chemistry 273 25488–25494.[Abstract/Free Full Text]

Dziadek M, Darling P, Zhang RZ, Pan TC, Tillet E, Timpl R & Chu ML 1995 Expression of collagen alpha 1(VI), alpha 2(VI), and alpha 3(VI) chains in the pregnant mouse uterus. Biology of Reproduction 52 885–894.[Abstract]

Foulkes NS, Borrelli E & Sassone-Corsi P 1991 CREM gene: use of alternative DNA-binding domains generates multiple antagonists of cAMP-induced transcription. Cell 64 739–749.[CrossRef][Web of Science][Medline]

Fuchs A, Fuchs F, Husslein P & Soloff M 1984 Oxytocin receptors in the human uterus during pregnancy and parturition. American Journal of Obstetrics and Gynecology 150 734–741.[Web of Science][Medline]

Fuchs SY, Tappin I & Ronai Z 2000 Stability of the ATF2 transcription factor is regulated by phosphorylation and dephosphorylation. Journal of Biological Chemistry 275 12560–12564.[Abstract/Free Full Text]

Gibellini D, Re MC, La Placa M & Zauli G 2002 Differentially expressed genes in HIV-1 tat-expressing CD4(+) T-cell line. Virus Research 90 337–345.[CrossRef][Web of Science][Medline]

Gogarten W, Lindeman KS, Hirshman CA & Emala CW 2003 Tumor necrosis factor alpha stimulates adenylyl cyclase activity in human myometrial cells. Biology of Reproduction 68 751–757.[Abstract/Free Full Text]

Goranova V, Vizza E & Motta PM 1993 Collagen fibrillar network in estrous and hCG-stimulated rabbit uterus: a SEM study after NaOH maceration. Archives of Histology and Cytology 56 231–241.[Web of Science][Medline]

Grammatopoulos D & Hillhouse E 1999 Role of corticotropin-releasing hormone in onset of labour. Lancet 354 1546–1549.[CrossRef][Web of Science][Medline]

Grammatopoulos D, Stirrat GM, Williams SA & Hillhouse EW 1996 The biological activity of the corticotropin-releasing hormone receptor-adenylate cyclase complex in human myometrium is reduced at the end of pregnancy. Journal of Clinical Endocrinology and Metabolism 81 745–751.[Abstract]

Gupta S, Campbell D, Derijard B & Davis RJ 1995 Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267 389–393.[Abstract/Free Full Text]

Hai T & Curran T 1991 Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. PNAS 88 3720–3724.[Abstract/Free Full Text]

Hai T, Liu F, Coukos WJ & Green MR 1989 Transcription factor ATF cDNA clones: an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes and Development 3 2083–2090. [published erratum, 1990 4 682][Abstract/Free Full Text]

Hayakawa J, Depatie C, Ohmichi M & Mercola D 2003 The activation of c-Jun NH2-terminal kinase (JNK) by DNA-damaging agents serves to promote drug resistance via activating transcription factor 2 (ATF2)-dependent enhanced DNA repair. Journal of Biological Chemistry 278 20582–20592.[Abstract/Free Full Text]

Helmer H, Tretzmuller U, Brunbauer M, Kaider A, Husslein P & Knofler M 2002 Production of oxytocin receptor and cytokines in primary uterine smooth muscle cells cultivated under inflammatory conditions. Journal of the Society for Gynecologic Investigation 9 15–21.[CrossRef][Web of Science][Medline]

Hertelendy F, Molnar M & Romero R 2002 Interferon gamma antagonizes interleukin-1 beta-induced cyclooxygenase-2 expression and prostaglandin E production in human myometrial cells. Journal of the Society for Gynecologic Investigation 9 215–219.[CrossRef][Web of Science][Medline]

Hochberg Y & Benjamini Y 1990 More powerful procedures for multiple significance testing. Statistics in Medicine 9 811–818.[Web of Science][Medline]

Hoeffler JP, Meyer TE, Yun Y, Jameson JL & Habener JF 1988 Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science 242 1430–1433.[Abstract/Free Full Text]

Karin M & Hunter T 1995 Transcriptional control by protein phosphorylation: signal transmission from the cell surface to the nucleus. Current Biology 5 747–757.[CrossRef][Web of Science][Medline]

Kawasaki H, Song J, Eckner R, Ugai H, Chiu R, Taira K, Shi Y, Jones N & Yokoyama KK 1998 p300 and ATF-2 are components of the DRF complex, which regulates retinoic acid- and E1A-mediated transcription of the c-jun gene in F9 cells. Genes and Development 12 233–245.[Abstract/Free Full Text]

Kawasaki H, Schiltz L, Chiu R, Itakura K, Taira K, Nakatani Y & Yokoyama KK 2000 ATF-2 has intrinsic histone acetyltransferase activity which is modulated by phosphorylation. Nature 405 195–200.[CrossRef][Medline]

Komatsu T, Konishi I, Fukumoto M, Nanbu K, Koshiyama M, Mandai M & Mori T 1997 Messenger ribonucleic acid expression of heat shock proteins HSP70 and HSP90 in human endometrium and myometrium during the menstrual cycle. Journal of Clinical Endocrinology and Metabolism 82 1385–1389.[Abstract/Free Full Text]

Kyriakis JM & Avruch J 2001 Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiological Reviews 81 807–869.[Abstract/Free Full Text]

Landschulz WH, Johnson PF & McKnight SL 1988 The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240 1759–1764.[Abstract/Free Full Text]

Ledingham MA, Thomson AJ, Jordan F, Young A, Crawford M & Norman JE 2001 Cell adhesion molecule expression in the cervix and myometrium during pregnancy and parturition. Obstetrics and Gynecology 97 235–242.[CrossRef][Web of Science][Medline]

Lee KA, Hai TY, SivaRaman L, Thimmappaya B, Hurst HC, Jones NC & Green MR 1987 A cellular protein, activating transcription factor, activates transcription of multiple E1A-inducible adenovirus early promoters. PNAS 84 8355–8359.[Abstract/Free Full Text]

Livingstone C, Patel G & Jones N 1995 ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO Journal 14 1785–1797.[Web of Science][Medline]

Ma C & Chegini N 1999 Regulation of matrix metalloproteinases (MMPs) and their tissue inhibitors in human myometrial smooth muscle cells by TGF-beta1. Molecular Human Reproduction 5 950–954.[Abstract/Free Full Text]

Maekawa T, Sakura H, Kanei-Ishii C, Sudo T, Yoshimura T, Fujisawa J, Yoshida M & Ishii S 1989 Leucine zipper structure of the protein CRE-BP1 binding to the cyclic AMP response element in brain. EMBO Journal 8 2023–2028.[Web of Science][Medline]

Maekawa T, Bernier F, Sato M, Nomura S, Singh M, Inoue Y, Tokunaga T, Imai H, Yokoyama M, Reimold A, Glimcher LH & Ishii S 1999 Mouse ATF-2 null mutants display features of a severe type of meconium aspiration syndrome. Journal of Biological Chemistry 274 17813–17819.[Abstract/Free Full Text]

Mandinova A, Soldi R, Graziani I, Bagala C, Bellum S, Landriscina M, Tarantini F, Prudovsky I & Maciag T 2003 S100A13 mediates the copper-dependent stress-induced release of IL-1 alpha from both human U937 and murine NIH 3T3 cells. Journal of Cell Science 116 2687–2696.[Abstract/Free Full Text]

Mayanil CS, George D, Freilich L, Miljan EJ, Mania-Farnell B, McLone DG & Bremer EG 2001 Microarray analysis detects novel Pax3 downstream target genes. Journal of Biological Chemistry 276 49299–49309.[Abstract/Free Full Text]

Montminy MR, Sevarino KA, Wagner JA, Mandel G & Goodman RH 1986 Identification of a cyclic-AMP-responsive element within the rat somatostatin gene. PNAS 83 6682–6686.[Abstract/Free Full Text]

Moore F, Da Silva C, Wilde JI, Smarason A, Watson SP & Lopez Bernal A 2000 Up-regulation of p21- and RhoA-activated protein kinases in human pregnant myometrium. Biochemical and Biophysical Research Communications 269 322–326.[CrossRef][Web of Science][Medline]

Moran CJ, Friel AM, Smith TJ, Cairns M & Morrison JJ 2002 Expression and modulation of Rho kinase in human pregnant myometrium. Human Reproduction 8 196–200.

Nishinaka K & Fukuda Y 1991 Changes in extracellular matrix materials in the uterine myometrium of rats during pregnancy and postparturition. Acta Pathologica Japonica 41 122–132.[Medline]

Oriji GK & Keiser HR 1996 Action of protein kinase C in endothelin-induced contractions in rat aortic rings. American Journal of Physiology 271 398–404.

Ouwens DM, de Ruiter ND, van der Zon GC, Carter AP, Schouten J, van der Burgt C, Kooistra K, Bos JL, Maassen JA & van Dam H 2002 Growth factors can activate ATF2 via a two-step mechanism: phosphorylation of Thr71 through the Ras-MEK-ERK pathway and of Thr69 through RalGDS-Src-p38. EMBO Journal 21 3782–3793.[CrossRef][Web of Science][Medline]

Park ES, Echetebu CO, Soloff S & Soloff MS 2002 Oxytocin stimulation of RGS2 mRNA expression in cultured human myometrial cells. American Journal of Physiology Endocrinology and Metabolism 282 580–584.

Phillippe M 1994 Protein kinase C, an inhibitor of oxytocin-stimulated phasic myometrial contractions. Biology of Reproduction 50 855–859.[Abstract]

Pollard JK & Mitchell MD 1996a Effects of gestational age on prostaglandin production and its regulation in human myometrial cells. Journal of Maternal and Fetal Medicine 5 93–98.

Pollard JK & Mitchell MD 1996b Intrauterine infection and the effects of inflammatory mediators on prostaglandin production by myometrial cells from pregnant women. American Journal of Obstetrics and Gynecology 174 682–686.[CrossRef][Web of Science][Medline]

Raingeaud J, Whitmarsh AJ, Barrett T, Derijard B & Davis RJ 1996 MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Molecular and Cellular Biology 16 1247–1255.[Abstract]

Read MA, Whitley MZ, Gupta S, Pierce JW, Best J, Davis RJ & Collins T 1997 Tumor necrosis factor alpha-induced E-selectin expression is activated by the nuclear factor-kappaB and c-JUN N-terminal kinase/p38 mitogen-activated protein kinase pathways. Journal of Biological Chemistry 272 2753–2761.[Abstract/Free Full Text]

Reimold AM, Grusby MJ, Kosaras B, Fries JW, Mori R, Maniwa S, Clauss IM, Collins T, Sidman RL, Glimcher MJ & Glimcher LH 1996 Chondrodysplasia and neurological abnormalities in ATF-2-deficient mice. Nature 379 262–265.[CrossRef][Medline]

Roh CR, Oh WJ, Yoon BK & Lee JH 2000 Up-regulation of matrix metalloproteinase-9 in human myometrium during labour: a cytokine-mediated process in uterine smooth muscle cells. Molecular Human Reproduction 6 96–102.[Abstract/Free Full Text]

Ronai Z, Yang YM, Fuchs SY, Adler V, Sardana M & Herlyn M 1998 ATF2 confers radiation resistance to human melanoma cells. Oncogene 16 523–531.[CrossRef][Web of Science][Medline]

Saalbach A, Aust G, Haustein UF, Herrmann K & Anderegg U 1997 The fibroblast-specific MAb AS02: a novel tool for detection and elimination of human fibroblasts. Cell and Tissue Research 290 593–599.[CrossRef][Web of Science][Medline]

Sparey C, Robson SC, Bailey J, Lyall F & Europe-Finner GN 1999 The differential expression of myometrial connexin-43, cyclooxygenase-1 and -2, and Gs alpha proteins in the upper and lower segments of the human uterus during pregnancy and labor. Journal of Clinical Endocrinology and Metabolism 84 1705–1710.[Abstract/Free Full Text]

Steinmuller L & Thiel G 2003 Regulation of gene transcription by a constitutively active mutant of activating transcription factor 2 (ATF2). Biological Chemistry 384 667–672.[CrossRef][Web of Science][Medline]

Suarez VR, Park ES, Hankins GD & Soloff MS 2003 Expression of regulator of G protein signaling-2 in rat myometrium during pregnancy and parturition. American Journal of Obstetrics and Gynecology 188 973–977.[CrossRef][Web of Science][Medline]

Tabibzadeh S, Kong QF & Babaknia A 1994 Expression of adhesion molecules in human endometrial vasculature throughout the menstrual cycle. Journal of Clinical Endocrinology and Metabolism 79 1024–1032.[Abstract]

Thomson AJ, Telfer JF, Young A, Campbell S, Stewart CJ, Cameron IT, Greer IA & Norman JE 1999 Leukocytes infiltrate the myometrium during human parturition: further evidence that labour is an inflammatory process. Human Reproduction 14 229–236.[Abstract/Free Full Text]

Turi A, Kiss AL & Mullner N 2001 Estrogen downregulates the number of caveolae and the level of caveolin in uterine smooth muscle. Cell Biology International 25 785–794.[CrossRef][Web of Science][Medline]

van Dam H & Castellazzi M 2001 Distinct roles of Jun : Fos and Jun : ATF dimers in oncogenesis. Oncogene 20 2453–2464.[CrossRef][Web of Science][Medline]

van Dam H, Wilhelm D, Herr I, Steffen A, Herrlich P & Angel P 1995 ATF-2 is preferentially activated by stress-activated protein kinases to mediate c-jun induction in response to genotoxic agents. EMBO Journal 14 1798–1811.[Web of Science][Medline]

Wagner S & Green MR 1994 DNA-binding domains: targets for viral and cellular regulators. Current Opinion in Cell Biology 6 410–414.[CrossRef][Web of Science][Medline]

Wu WX, Derks JB, Zhang Q & Nathanielsz PW 1996 Changes in heat shock protein-90 and –70 messenger ribonucleic acid in uterine tissues of the ewe in relation to parturition and regulation by estradiol and progesterone. Endocrinology 137 5685–5693.[Abstract]

Yamamoto KK, Gonzalez GA, Biggs WD & Montminy MR 1988 Phosphorylation-induced binding and transcriptional efficacy of nuclear factor CREB. Nature 334 494–498.[CrossRef][Medline]

Yelavarthi KK, Chen HL, Yang YP, Cowley BD Jr, Fishback JL & Hunt JS 1991 Tumor necrosis factor-alpha mRNA and protein in rat uterine and placental cells. Journal of Immunology 146 3840–3848.[Abstract]

Young A, Thomson AJ, Ledingham M, Jordan F, Greer IA & Norman JE 2002 Immunolocalization of proinflammatory cytokines in myometrium, cervix, and fetal membranes during human parturition at term. Biology of Reproduction 66 445–449.[Abstract/Free Full Text]

Ziff EB 1990 Transcription factors: a new family gathers at the cAMP response site. Trends in Genetics 6 69–72.[CrossRef][Web of Science][Medline]

Received 4 August 2004
Accepted 13 September 2004
Made available online as an Accepted Preprint 4 October 2004




This article has been cited by other articles:


Home page
ReproductionHome page
M. Breuiller-Fouche and G. Germain
Gene and protein expression in the myometrium in pregnancy and labor.
Reproduction, May 1, 2006; 131(5): 837 - 850.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bailey, J.
Right arrow Articles by Europe-Finner, G N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bailey, J.
Right arrow Articles by Europe-Finner, G N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS