|
|
||||||||
Department of Biosciences, Karolinska Institutet at NOVUM, Huddinge, Sweden
1 Genome Institute of Singapore, 60 Biopolis Street, The Genome, #02-01, Singapore 138672
2 Division of Endocrinology and Metabolism, Department of Internal Medicine III, University of Vienna, and CeMM Center of Molecular Medicine, Austrian Academy of Sciences, Vienna, Austria
(Requests for offprints should be addressed to K R Steffensen; Email: knut.steffensen{at}biosci.ki.se)
| Abstract |
|---|
|
|
|---|
and ß (LXR
and LXRß ) are members of the nuclear receptor superfamily of proteins which are highly expressed in metabolically active tissues. They regulate gene expression of critical genes involved in cholesterol catabolism and transport, lipid and triglyceride biosynthesis and carbohydrate metabolism in response to distinct oxysterols and intermediates in the cholesterol metabolic pathway. The biological roles of the LXRs in tissues other than liver, intestine and adipose tissue are poorly elucidated. In this study we used global gene-expression profiling analysis to detect differences in expression patterns in several tissues from mice fed an LXR agonist or vehicle. Our results show that LXR plays an important role in the kidney, lung, adrenals, brain, testis and heart where several putative LXR target genes were found. The effects of the LXRs were further analysed in adrenals where treatment with an LXR agonist induced expression of adrenocorticotrophic hormone receptor, suppressed expression of uncoupling protein (UCP)-1 and UCP-3 as well as several glycolytic enzymes and led to increased serum corticosterone levels. These results indicate novel biological roles of the LXR including regulation of energy metabolism, glycolysis and steroidogenesis in the adrenals via alteration of expression profiles of putative target genes.
| Introduction |
|---|
|
|
|---|
and LXRß , which are activated upon binding of ligand. Endogenous ligands most probably comprise distinct oxysterols, namely 20(S)- and 22(R)-hydroxycholesterol and 20,22-dihydroxycholesterol (Janowski et al. 1996). Together with the retinoid X receptor (RXR), LXR binds as an LXRRXR heterodimer to specific DR4 response elements (direct hexameric repeats spaced by four nucleotides) in promoters of their cognate target genes (Willy et al. 1995). Whereas LXRß is expressed ubiquitously, high expression of LXR
is restricted to liver, adipose tissue, small intestine and macrophages (Willy et al. 1995, Auboeuf et al. 1997). The LXRs have recently gained much attention for their role in cholesterol, lipid and carbohydrate metabolism (reviewed in Steffensen and Gustafsson 2004).
The LXRs play a pivotal role in cholesterol and lipid metabolism by various mechanisms. LXR
/ but not LXRß / mice show significant increase in hepatic cholesterol content (Alberti et al. 2001), and pronounced changes in blood lipid profiles have been observed in LXR
//LXRß / mice (Schuster et al. 2002). LXRs promote lipogenesis by inducing transcription of several key lipogenic enzymes and LXR
//LXRß / mice have less adipose tissue than their wild-type littermates (Juvet et al. 2003). The ATP-binding cassette (ABC) transporters ABCA1 and ABCG1 facilitate cholesterol efflux from, for example, macrophages thereby preventing foam cell formation and atherogenesis. Apolipoprotein E (apoE) is another crucial player in reverse cholesterol transport, facilitating incorporation of cholesterol into high-density lipoprotein particles for transport to the liver. Both the ABCA1/G1/G5/G8 transporters (Costet et al. 2000, Kennedy et al. 2001, Repa et al. 2002) and the apoE/C-I/C-IV/C-II gene cluster (Mak et al. 2002) are induced by the LXRs, indicating important roles of LXR in suppression of atherosclerosis. Expression of gluconeogenic enzymes was significantly downregulated in livers of animals treated with an LXR agonist (Stulnig et al. 2002a, 2002b). Suppression of gluconeogenetic enzymes in liver, induction of GLUT4 and improved glucose tolerance by activation of LXR have also been reported (Dalen et al. 2003, Laffitte et al. 2003). Another study showed reduced blood glucose levels in diabetic rodents, increased insulin sensitivity in insulin-resistant Zucker rats and expression of gluconeogenic genes were suppressed leading to decreased hepatic glucose output upon treatment of an LXR agonist (Cao et al. 2003).
The findings described above suggest that the main target tissues of the LXRs are liver and adipose tissue where their function has been carefully studied and the results strongly indicate important roles of LXRs in nutrient metabolism. As most of the LXR target genes have been identified in liver, intestines and adipose tissue, the role of the LXRs in other tissues remains obscure. In this study, we have analysed the role of the LXRs in several tissues by genome-wide expression-profiling analysis of seven organs including liver, lung, kidney, brain, testis, adrenal and heart from mice treated orally with a synthetic LXR agonist. Changes in expression profiles due to treatment observed in wild-type mice were compared with those observed in LXR
//LXRß / mice to ensure LXR-specific regulation. Beyond confirming earlier results and identifying additional candidate target genes of LXR in lipid and cholesterol metabolism, we disclose unknown putative LXR target genes suggesting novel biological functions of the LXRs in lung, kidney, brain, testis, adrenal and heart.
| Materials and methods |
|---|
|
|
|---|
LXR
//LXRß / double-targeted knockout mice were generated in our laboratory as described previously (Schuster et al. 2002). The mice used in this study were male Sv129/C57BL/6 hybrids backcrossed in C57BL/6 mice for three generations. Mice were housed under a 12-h/12-h light/dark cycle in the specific pathogen-free animal unit at the Karolinska University Hospital in Huddinge, Sweden. For the experiment, mice were 1012 months of age, had free access to water and an experimental diet based on a low-fat standard rodent diet (R36; Lactamin AB, Vadstena, Sweden). The diet was either mixed with vehicle alone (ethanol) or supplemented with 0.025% (w/w) of the synthetic LXR agonist T0901317 (referred to hereon as T1317; Repa et al. 2000) and was dried extensively to evaporate any traces of ethanol. Four wild-type and four LXR
//LXRß / mice were assigned to each experimental group, except for liver where three animals were used, and treated for 7 days. Mice were killed and tissues snap-frozen in liquid nitrogen and kept at 80 °C until isolation of RNA. The experiments were approved by the local ethical committee for animal experiments and the guidelines for the use and care of laboratory animals followed.
Microarray experiments
RNA was linearly amplified for two rounds using a procedure modified from Eberwine et al.(1992). Total RNA was reverse-transcribed using a 63-nucleotide synthetic primer containing the T7 polymerase-binding site: 5'-GGCCAGTGAA TTGTAATACGACTCACTATAGGGAGGCGG (T)24-3'. Full-length double-stranded cDNA synthesis was performed in the presence of Escherichia coli DNA polymerase I, DNA ligase and RNase H. The cDNA was made blunt-ended with T4 DNA polymerase, and purified by extraction in a mixture of phenol, chloroform and isoamyl alcohol, and precipitation in the presence of ammonium acetate and ethanol. Purified double-stranded cDNA was then transcribed with T7 polymerase (T7 Megascript kit; Ambion, Austin, TX, USA) to yield linearly amplified antisense RNA, which was subsequently purified with RNeasy mini-columns (Qiagen).
For the second round of amplification, an aliquot of the amplified RNA was reverse-transcribed to cDNA in the presence of random hexamer oligonucleotides. Second-strand cDNA synthesis was initiated in the presence of oligo(dT) T7 primer containing the T7 polymerase-binding site (as described above) in the presence of E. coli DNA polymerase I, DNA ligase and RNase H. The purification of cDNA and in vitro transcription was carried out as before. Mouse universal reference RNA (Stratagene), which comprised of total RNA from 11 different mouse cell lines, was amplified and used as the reference for cDNA microarray analysis.
A total of approximately 10 000 mouse cDNA features (Incyte Genomics, Palo Alto, CA, USA) were spotted on to poly-L-lysine-coated slides using the OmniGrid arrayer (GeneMachines, Ann Arbor, MI, USA). Probes were generated from the amplified RNA material and hybridized to the chip as described elsewhere (Sotiriou et al. 2002). Briefly, 4 µg amplified RNA was reverse-transcribed using random hexamers and labelled directly with Cy3-conjugated dUTP (reference RNA) or Cy5-conjugated dUTP (sample RNA). Hybridization was performed in the presence of 25% formamide and 5xSSC for 16 h at 42 °C. Slides were scanned with an Axon 4000B laser scanner (Axon Instruments, Union City, CA, USA) after washing and drying. To minimize the effects of labelling biases, reciprocal dye-swap labelling experiments were performed for each individual mouse tissue sample. Genes found to be regulated in LXR
//LXRß / mice upon LXR agonist feeding as well as in wild-type mice were subtracted and are not presented as putative LXR target genes.
Data analysis
Raw data were analysed on GenePix analysis software version 4.0 (Axon Instruments) and uploaded to a relational database. The cDNA clones used for the microarray are represented by their UniGene identifiers. The logarithmic expression ratio for a spot on each array was normalized by subtracting the median logarithmic ratio for the same array. Data were filtered to exclude spots with a size of less than 25 µm and any poor-quality or missing spots. Gene features that were found to be absent from the data in more than 50% of the arrays for each tissue were also excluded. Application of these filters resulted in the inclusion of between 9400 and 9600 genes in the subsequent analyses. This approach was based on the rationale of including as many data points as possible to capture maximal information in the early stage of the analysis. The correlation of the overall data from reciprocal labelling was good (approximately 0.8 on average). To identify outlier genes due to treatment in each group of animals (wild-type and knockout mice), the replicates of each individual mouse tissue sample (reciprocal dye-swap-labelled experiments) were treated as individual data points and the Wilcoxon rank-sum non-parametric test was applied. Genes were identified as putative LXR target genes if they were only found to be outliers due to treatment specifically in wild-type mice (P<0.01). To evaluate gene-expression patterns by hierarchical clustering, the pair of replicates for each mouse tissue specimen was averaged and treated as a single data point, and clustering using Pearsons uncentred correlation metric and average linkage (Eisen et al. 1998) was performed on normalized data (mean=0, S.D.=1) of the averaged values. Genes that showed at least 1.3-fold change in expression (P<0.01) were selected for further downstream analyses (see Results). The data set and annotated list of putative LXR target genes are available for downloading as additional supplementary material at http://www.gis.a-star.edu.sg/supplmat/neosy/LXRmouse.html.
Quantitative-PCR (Q-PCR) and primer designs
Total RNA was isolated from tissues using Trizol reagent (Invitrogen) according to the manufacturers instructions. RNA was further purified by the RNeasy kit (Qiagen) and checked for quality by spectrophotometry at 260/280 nm and 1.5% agarose gel electrophoresis. A total of 1 µg RNA was treated with DNase I (amplification grade; Invitrogen) before reverse transcription into cDNA by Superscript II (Invitrogen) using random hexamer priming according to the manufacturers instructions. mRNA expression was quantified with SYBRgreen chemistry on an ABI 7700 machine (Applied Biosystems) and a direct comparative method was used for data analysis. Expression of the gene of interest were normalized to the 18 S internal standard. All Q-PCR reactions were run with 20 ng cDNA as template except for the 18 S internal control where 40 pg cDNA were used. Primer sequences for the analysed genes were designed using PrimerExpress 1.5a (Applied Biosystems) and all sequences are available upon request. The efficiency of the Q-PCR reaction for 18 S and the genes of interest was 95100%, calculated using a standard curve and the following formula: Efficiency of PCR=(10 1/slope of standard curve) 1 (for more details see User Bulletin #2, Applied Biosystems, www.appliedbiosystems.com). Students t tests on average expression from the four mice (n=4) were performed to determine the level of significance of the changes observed between wild-type vehicle and LXR T1317 agonist-treated animals and the P value is indicated in the text or the respective Figure.
Hormone analysis and statistics
Serum corticosterone concentration in each mouse was determined by RIA as follows; 50 µl serum were extracted with 1.0 ml ethyl acetate and centrifuged at room temperature at 2000 g for 5 min. 100 µl from the clear ethyl acetate phase was transferred in triplicates into polypropylene tubes, evaporated under vacuum and redissolved with assay buffer. RIA was carried out using tritiated corticosterone (New England Nuclear), anti-corticosterone (Sigma) and charcoal/dextran as a separating agent.
Cell cultures
Murine Y1 adrenocortical tumour and HIB-1B preadipocyte cells were maintained in Dulbeccos modified Eagles medium (Art. no. 41965039) 4500 g/l glucose, supplemented with 10% fetal bovine serum, 2 mM penicillin and 2 mM streptomycin and maintained in a 5% CO2 humidified atmosphere at 37 °C. HIB-1B cells were differentiated using the following protocol: cells were grown in standard growth medium and when cells reached tight confluence they were refed with the same medium supplemented with 18 nM insulin, 1 nM T3, 0.5 mM isobutylmethylxanthine (IBMX), 0.5 µM hydrocortisone and 0.125 mM indomethacin. Then, 3 days later, cells were placed back in standard growth medium in the presence of 18 nM insulin, 1 nM T3 and 0.5 µM BRL 49653 (a peroxisome proliferator-activated receptor (PPAR)
agonist) and incubated for an additional 4 days. Cell culture medium was replaced every 48 h.
| Results |
|---|
|
|
|---|
// LXRß / mice were also treated similarly to wild-type mice to identify gene responses solely mediated through LXR. At the end of the treatment, liver, kidneys, lungs, heart, brain, testis and adrenals were isolated from all mice and total RNA was extracted from the tissues and amplified for transcriptional profiling analyses on cDNA microarrays containing approximately 10 000 gene features. Reciprocal dye-swap replicate hybridizations were performed to minimize technical noise. For each tissue, we investigated the differential patterns of gene expression between the vehicle-treated group and the group fed with LXR agonist using the Wilcoxon rank-sum test, and asked whether genes that were differentially expressed upon treatment with the LXR agonist in the wild-type mice showed any change in expression in the LXR
//LXRß / mice.
Hierarchical clustering analyses based on the differentially expressed genes (P<0.01) showed distinct LXR agonist-induced changes in wild-type mice that were completely absent in LXR
// LXRß / mice in liver, adrenal, kidney, brain, testis, lung and heart tissues (see supplementary Fig. 1
on http://jme.endocrinology-journals.org/content/vol33/issue3/). Induction of known target genes such as ABCA1/G1/G5, fatty acid synthase (FAS), lipoprotein lipase (LPL) and cholesterol 7
-hydroxylase (Cyp7
1); (see Steffensen and Gustafsson 2004 and references therein) was detected upon LXR agonist treatment in the liver of wild-type mice. We also found downregulation of phosphoenolpyruvate carboxykinase (PEPCK) expression in livers of LXR-agonist-treated mice as demonstrated previously (Stulnig et al. 2002b). However, the expression showed high variance and did not pass our selection criteria for inclusion in further annotations. These observations are in good concordance with the literature and also suggest that this approach is useful in discovering novel LXR target genes (Fig. 1
). In wild-type mice, the largest number of LXR-regulated genes was found in liver and heart, followed by lung, adrenal, kidney, testis and brain (Fig. 2
). Relatively more genes were induced upon treatment with an LXR agonist in liver and testis, while more genes were suppressed in kidney. The other tissues showed approximately equal numbers of up- and down-regulated genes. The majority of tissues, except brain, exhibited fewer genes with altered expression profiles in the LXR
//LXRß / mice than those observed in the wild-type mice (Fig. 3
) suggesting non-LXR-mediated effects of the T1317 LXR agonist since the transcriptional alterations in the LXR
//LXRß / mice cannot be due to LXR effects. A few genes showed altered expression in both wild-type and LXR
// LXRß / mice and these common genes were excluded from further analyses of LXR-specific targets. Taken together, these data suggest the importance of LXR regulation in various tissues.
|
|
|
|
Interestingly, several genes in the glycolysis pathway as well as protease inhibitors were suppressed in adrenals upon LXR agonist treatment while expression of 7-dehydrocholesterol reductase and melanocortin 2 receptor (adrenocorticotropic hormone (ACTH) receptor) were induced (Fig. 5
). The altered expression profiles of the majority of these genes were also verified by Q-PCR (Fig. 6
).
|
|
//LXRß / mice (Fig. 7
//LXRß / mice compared with untreated wild-type mice (P<0.01), indicating that LXRs are likely to be involved both in maintaining basal levels of adrenal glucocorticoid production, and in controlling adaptive changes in glucocorticoid levels.
|
//LXRß / mice prompted us to look at differences in expression profiles between these groups as well. A large number of genes showed altered expression levels in wild-type mice versus LXR
//LXRß / mice in both liver and adrenal (Fig. 8
//LXRß / mice in liver and adrenal are shown as supplementary Fig. 2A and B
|
|
and LXRß were expressed in this cell line (results not shown), further suggesting that the LXRs have a direct effect in adrenal. The Y1 cell line did not express UCP-1 so in order to investigate the effect of LXR on UCP-1 expression we used the murine HIB-1B preadipocyte cell line which was differentiated and treated with norepinephrine to express UCP-1 (Rabelo et al. 1997). Treatment with LXR agonist significantly reduced UCP-1 expression by 60% (P<0.005; Fig. 9C| Discussion |
|---|
|
|
|---|
The UCP family is located in mitochondria where they uncouple respiration from ATP synthesis, dissipating the proton gradient as heat. We observed that expression of both UCP-1 and UCP-3 is highly suppressed in adrenals following treatment of wild-type mice with an LXR agonist. UCP-1 is considered to be expressed exclusively in brown adipose tissue while UCP-3 is expressed mostly in skeletal muscles (Del Mar Gonzalez-Barroso et al. 2000). To our knowledge, expression of UCPs has not previously been analysed in adrenals. A very low expression level of adipose fatty acid-binding protein (aFABP), an adipose-tissue-specific protein, was detected in our adrenal samples. Hence, we cannot completely rule out the possibility of small contamination of RNA from adipose tissue in the RNA from adrenal. However, perirenal fat deposits are of white adipose tissue origin and should not express UCP-1 (Del Mar Gonzalez-Barroso et al. 2000), indicating that the monitored UCP-1 expression is adrenal-specific, a notion further supported by the Q-PCR detection of UCP-1 expression in commercially available RNA from human adrenals (results not shown). Both UCP-1 and UCP-3 have been suggested to be involved in energy expenditure (Del Mar Gonzalez-Barroso et al. 2000, Schrauwen 2002). Additionally, UCP-3 increases glucose uptake and synthesis of GLUT4, the major insulin-sensitive glucose transporter in muscle (Huppertz et al. 2001), and is involved in the flux of lipid substrates across the mitochondrial membrane (Dulloo & Samec 2001). UCP-1 has also been suggested to transport fatty acids across the mitochondrial membrane (Garlid et al. 2000). These data suggest a novel role in which the LXRs are involved in the control of transport of lipids and carbohydrates, not only as inducers or suppressors of target genes involved in lipid biosynthesis and glucose production (i.e. gluconeogenesis). Also, most significantly, these observations suggest that LXR might be involved in control of energy expenditure.
One of the most intriguing findings was the upregulation of the ACTH receptor by the LXR agonist in adrenals. The production of steroid hormones in the adrenal cortex is regulated predominantly by ACTH which acts via its transmembrane receptor (MC2-R/ACTH-receptor) to turn on intracellular signalling cascades (Beuschlein et al. 2001). ACTH is a product of the pro-opiomelanocortin (POMC) gene that is primarily expressed in the pituitary gland, but its expression has been detected in numerous other tissues (Smith & Funder 1988), whereas the ACTH receptor is mainly expressed in the adrenal cortex (Beuschlein et al. 2001). ACTH receptor expression was induced 3-fold by LXR agonist treatment in wild-type mice. In parallel, there was a 4-fold higher serum concentration of corticosterone in LXR-agonist-treated wild-type animals. There was a direct effect of LXR in Y1 cells as demonstrated by induced ABCA1 expression upon treatment with an LXR agonist. Y1 cells, which originate from adrenal cortex, expresses both the LXRs, further indicating a direct effect of the LXR in adrenal cortex. However, expression of the ACTH receptor was not altered upon treatment of an LXR agonist in Y1 cells. This observation also speaks in favour of indirect mechanisms of LXR effects.
A 5-fold-higher serum concentration of corticosterone in untreated LXR
//LXRß / mice compared with untreated wild-type mice provides further evidence for the involvement of the LXRs in adrenal steroidogenesis. These results suggest a tight regulation of glucocorticoid production by the LXRs. Higher levels of corticosterone in the absence of the LXRs indicate that, when unactivated by exogenous ligand, these receptors suppress basal glucocorticoid production, but, in contrast, induce glucocorticoid production upon activation by an LXR agonist. Such a dual function of unactivated versus activated nuclear receptor is also seen in case of the thyroid hormone receptor (Koenig 1998), for example. Surprisingly, no difference was seen in expression levels of the ACTH receptor in wild-type versus LXR
// LXRß / mice. The physiological mechanism behind the strongly upregulated serum corticosterone levels in the double-knockout animals is therefore unclear. Both 20(S)- and 22(R)-hydroxycholesterol are early intermediates in adrenal steroid hormone production and also are among the most potent endogenous agonists of the LXRs (Janowski et al. 1996, Forman et al. 1997, Lehmann et al. 1997). Hence, the adrenals contain endogenous LXR agonists, which, according to our observations, induce adrenal steroid hormone production (positive feed-forward control). We are currently investigating whether the stimulation of glucocorticoid production by the LXRs involves direct or indirect regulation of steroidogenic enzymes.
There is a growing body of evidence that serine proteases play an essential role in hormone biosynthesis in endocrine organs (Hill et al. 2002). Our data show that expression of several serine protease inhibitors in adrenals is suppressed by LXR agonist treatment including Spil-1, -3 and -4 (Figs 5
and 6
). The functions of Spil protease inhibitors are poorly elucidated. They are suggested to consist of a five-member multigene family of anti-proteases with homologous functions to the human
1-anti-trypsin (Tardiff & Krauter 1998). Spil-1 has moderate affinity to thrombin, and thrombin has been shown to increase aldosterone secretion from the adrenals (Raven et al. 2001). A family of G-protein-coupled receptors termed protease-activated receptors (PARs) has been identified that is activated by thrombin and trypsin (reviewed in Kawabata & Kuroda 2000) and activation of PAR-1 stimulates aldosterone secretion from adrenals (Raven et al. 2001). The LXRs might suppress expression of protease inhibitors to prevent them from interfering with cleavage of, for example, thrombin and trypsin, thereby maintaining increased adrenal steroid synthesis. Expression of Spil-1, -3 and -4 was also reduced in LXR
//LXRß / mice compared with wild-type mice in adrenals (supplementary Fig. 2A
), which could be an explanation to the increased serum corticosterone levels observed in LXR
/ /LXRß / mice, if our speculation above holds true. Also, the expression of serum/glucocorticoid-regulated kinase is induced in LXR
//LXRß / mice compared with wild-type mice (supplementary Fig. 2B
), suggesting more than one plausible explanation to the altered corticosterone levels between these groups.
Furthermore, 7-dehydrocholesterol reductase, whose expression is induced by the LXR agonist in adrenals, is involved in cholesterol biosynthesis where it catalyses the reduction of 7-dehydrocholesterol to cholesterol. Defects in this gene lead to impaired cholesterol biosynthesis and the gene has been linked to exaggerated 17
-hydroxyprogesterone response to ACTH as well as adrenal hyperplasia, adrenal insufficiency, disorders of fetal adrenals, multiple congenital anomalies and mental retardation syndrome (see Porter 2000 and references therein). These results provide another line of evidence for a role for the LXRs in adrenal steroid production. Interestingly, a previous study in our laboratory showed that the LXRs suppress expression of 11ß-hydroxysteroid dehydrogenase-1 (11ß-HSD-1) in vitro and in vivo (Stulnig et al. 2002a). This enzyme converts biologically inactive glucocorticoids to active hormones and is expressed abundantly in liver and adipose tissue (Bujalska et al. 1997). Thus LXRs appear to regulate not only glucocorticoid production but also local action of glucocorticoids in target tissues.
The difference in both corticosterone levels and expression profiles in wild-type mice versus LXR
//LXRß / mice indicates that the LXRs also serve a regulatory function of target genes when not activated. A study by Lala and colleagues (Hu et al. 2003) showed interaction between the LXRs and the corepressors SMRT (silent mediator of retinoic acid receptor and thyroid receptor) and N-CoR (nuclear receptor corepressor), which was interrupted upon ligand binding. Both SMRT and N-CoR are known to inhibit gene expression when bound to nuclear receptors. A recent study by Wagner et al.(2003) showed that the LXRs interact with N-CoR and SMRT when not bound to ligand, repressing expression of ABCA1 in macrophages. Dissociation or loss of the LXRs leads to derepression of ABCA1 expression, suggesting that the LXRs work as suppressors of ABCA1 expression when unliganded in agreement with our observation of significantly increased ABCA1 expression in lung, heart and testis of LXR
//LXRß / mice (results not shown).
Discrepancies between the regulatory potential of the LXR isoforms have been reported that might be due to different affinity of the isoforms to an LXRE (LXR response element) (Feltkamp et al. 1999, Zhang et al. 2001, Li et al. 2002). Furthermore, PPAR
and PPAR
have been shown to compete with LXR
for its heterodimer partner, RXR, abolishing binding of LXR
to the LXRE (Yoshikawa et al. 2003). Our observations further strengthen the notion that the regulatory mechanisms of the LXRs might be more complex than anticipated previously.
Only a few putative LXR target genes were found in brain and testis. Both tissues have a barrier against the circulating blood system providing protection from passive diffusion of compounds into these tissues, suggesting that this barrier might have been an obstacle for the entry of the T1317 compounds in these tissues. Expression of numerous genes was affected by T1317 treatment in brain and testis from LXR
// LXRß / mice, contradicting the theory that the barrier does not allow entry of the T1317 compound in these tissues. Although speculative, it might be that the barrier in LXR
// LXRß / mice is somehow disrupted, facilitating the entry of the T1317 compound which then exerts its non-LXR mediated effects.
Finally, our study indicates that treatment with an LXR agonist leads to suppressed expression of several glycolytic genes in adrenal. We have previously observed similar results in white and brown adipose tissue (Stulnig et al. 2002b) where we postulated that the LXRs mediate reduced glycolysis in extrahepatic tissues which is in agreement with this study. The many reports of the roles of LXRs in lipid and carbohydrate metabolism have led to expectations that LXRs could serve as drug targets for treatment of metabolic disorders (Steffensen & Gustafsson 2004). The suppression of PEPCK expression (Stulnig et al. 2002a), leading to inhibition of gluconeogenesis, and reduced plasma glucose levels (Cao et al. 2003) mediated by an LXR agonist could mediate beneficial effects in diabetes mellitus type 2. On the other hand, induction of lipogenesis leading to hypertriglyceridaemia as well as the observations made in this study where increased production of glucocorticoids was seen, indicate that the LXRs interfere with metabolic regulation in a much more complex manner than anticipated previously.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Auboeuf D, Rieusset J, Fajas L, Vallier P, Frering V, Riou JP, Staels B, Auwerx J, Laville M & Vidal H 1997 Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-activated receptors and liver X receptor-alpha in humans no alteration in adipose tissue of obese and NIDDM patients. Diabetes 46 13191327.[Abstract]
Beuschlein F, Fassnacht M, Klink A, Allolio B & Reincke M 2001 ACTH-receptor expression, regulation and role in adrenocortial tumor formation. European Journal of Endocrinology 144 199206.[Abstract]
Bujalska IJ, Kumar S & Stewart PM 1997 Does central obesity reflect Cushings disease of the omentum? Lancet 349 12101213.[CrossRef][Web of Science][Medline]
Cao G, Liang Y, Broderick CL, Oldham BA, Beyer TP, Schmidt RJ, Zhang Y, Stayrook KR, Suen C, Otto KA et al. 2003 Antidiabetic action of a liver x receptor agonist mediated by inhibition of hepatic gluconeogenesis. Journal of Biological Chemistry 278 11311136.
Costet P, Luo Y, Wang N & Tall AR 2000 Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. Journal of Biological Chemistry 275 2824028245.
Dalen KT, Ulven SM, Bamberg K, Gustafsson J-Å & Nebb HI 2003 Expression of the insulin responsive glucose transporter GLUT4 in adipocytes is dependent on liver X receptor. Journal of Biological Chemistry 278 4828348291.
Del Mar Gonzalez-Barroso M, Ricquier D & Cassard-Doulcier AM 2000 The human uncoupling protein-1 gene (UCP1) present status and perspectives in obesity research. Obesity Reviews 1 6172.
Dulloo AG & Samec S 2001 Uncoupling proteins their roles in adaptive thermogenesis and substrate metabolism reconsidered. British Journal of Nutrition 86 123139.[Web of Science][Medline]
Eberwine J, Spencer C, Miyashiro K, Mackler S & Finnell R 1992 Complementary DNA synthesis in situ methods and applications. Methods in Enzymology 216 80100.[Web of Science][Medline]
Eisen MB, Spellman PT, Brown PO & Botstein D 1998 Cluster analysis and display of genome-wide expression patterns. PNAS 95 1486314868.
Feltkamp D, Wiebel FF, Alberti S & Gustafsson J-Å 1999 Identification of a novel DNA binding site for nuclear orphan receptor OR1. Journal of Biological Chemistry 274 1042110429.
Forman BM, Ruan B, Chen J, Schroepfer GJ Jr & Evans RM 1997 The orphan nuclear receptor LXRalpha is positively and negatively regulated by distinct products of mevalonate metabolism. PNAS 94 1058810593.
Garlid KD, Jaburek M, Jezek P & Varecha M 2000 How do uncoupling proteins uncouple? Biochimica Biophysica Acta 1459 383389.[Medline]
Hill RM, Coates LC, Parmar PK, Mezey E, Pearson JF & Birch NP 2002 Expression and functional characterization of the serine protease inhibitor neuroserpin in endocrine cells. Annals of the New York Academy of Sciences 971 406415.[Web of Science][Medline]
Hu X, Li S, Wu J, Xia C & Lala DS 2003 Liver x receptors interact with corepressors to regulate gene expression. Molecular Endocrinology 17 10191026.
Huppertz C, Fischer BM, Kim YB, Kotani K, Vidal-Puig A, Slieker LJ, Sloop KW, Lowell BB & Kahn BB 2001 Uncoupling protein 3 (UCP3) stimulates glucose uptake in muscle cells through a phosphoinositide 3-kinase-dependent mechanism. Journal of Biological Chemistry 276 1252012529.
Janowski BA, Willy PJ, Devi TR, Falck JR & Mangelsdorf DJ 1996 An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 383 728731.[CrossRef][Medline]
Juvet LK, Andresen SM, Schuster GU, Dalen KT, Tobin KA, Hollung K, Haugen F, Jacinto S, Ulven SM, Bamberg K et al. 2003 On the role of liver x receptors in lipid accumulation in adipocytes. Molecular Endocrinology 17 172182.
Kawabata A & Kuroda R 2000 Protease-activated receptor (PAR), a novel family of G protein-coupled seven trans-membrane domain receptors activation mechanisms and physiological roles. Japanese Journal of Pharmacology 82 171174.[CrossRef][Medline]
Kennedy MA, Venkateswaran A, Tarr PT, Xenarios I, Kudoh J, Shimizu N & Edwards PA 2001 Characterization of the human ABCG1 gene liver X receptor activates an internal promoter that produces a novel transcript encoding an alternative form of the protein. Journal of Biological Chemistry 276 3943839447.
Koenig RJ 1998 Thyroid hormone receptor coactivators and corepressors. Thyroid 8 703713.[Web of Science][Medline]
Laffitte BA, Chao LC, Li J, Walczak R, Hummasti S, Joseph SB, Castrillo A, Wilpitz DC, Mangelsdorf DJ, Collins JL et al. 2003 Activation of liver X receptor improves glucose tolerance through coordinate regulation of glucose metabolism in liver and adipose tissue. PNAS 100 54195424.
Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su JL, Sundseth SS, Winegar DA, Blanchard DE, Spencer TA & Willson TM 1997 Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. Journal of Biological Chemistry 272 31373140.
Li Y, Bolten C, Bhat BG, Woodring-Dietz J, Li S, Prayaga SK, Xia C & Lala DS 2002 Induction of human liver X receptor alpha gene expression via an autoregulatory loop mechanism. Molecular Endocrinology 16 506514.
Lowell BB & Spiegelman BM 2000 Towards a molecular understanding of adaptive thermogenesis. Nature 404 652660.[Medline]
Mak PA, Laffitte BA, Desrumaux C, Joseph SB, Curtiss LK, Mangelsdorf DJ, Tontonoz P & Edwards PA 2002 Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. A critical role for nuclear liver X receptors alpha and beta. Journal of Biological Chemistry 277 3190031908.
Porter FD 2000 RSH/Smith-Lemli-Opitz syndrome a multiple congenital anomaly/mental retardation syndrome due to an inborn error of cholesterol biosynthesis. Molecular Genetics and Metabolism 71 163174.[CrossRef][Web of Science][Medline]
Rabelo R, Camirand A & Silva JE 1997 3',5'-cyclic adenosine monophosphate-response sequences of the uncoupling protein gene are sequentially recruited during darglitazone-induced brown adipocyte differentiation. Endocrinology 138 53255332.
Raven PW, Kapas S, Carroll M & Hinson JP 2001 Aldosterone secretion by the rat adrenal cortex is stimulated by the activation of protease-activated receptor 1. Journal of Endocrinology 169 581585.[Abstract]
Repa JJ, Turley SD, Lobaccaro JA, Medina J, Li L, Lustig K, Shan B, Heyman RA, Dietschy JM & Mangelsdorf DJ 2000 Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science 289 15241529.
Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H & Mangelsdorf DJ 2002 Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. Journal of Biological Chemistry 277 1879318800.
Schrauwen P 2002 Skeletal muscle uncoupling protein 3 (UCP3) mitochondrial uncoupling protein in search of a function. Current Opinion in Clinical Nutrition and Metabolic Care 5 265270.[CrossRef][Web of Science][Medline]
Schuster GU, Parini P, Wang L, Alberti S, Steffensen KR, Hansson GK, Angelin B & Gustafsson J-Å 2002 Accumulation of foam cells in liver X receptor-deficient mice. Circulation 106 11471153.
Smith AI & Funder JW 1988 Proopiomelanocortin processing in the pituitary, central nervous system, and peripheral tissues. Endocrine Reviews 9 159179.
Sotiriou C, Powles TJ, Dowsett M, Jazaeri AA, Feldman AL, Assersohn L, Gadisetti C, Libutti SK & Liu ET 2002 Gene expression profiles derived from fine needle aspiration correlate with response to systemic chemotherapy in breast cancer. Breast Cancer Research 4 R3.[CrossRef][Medline]
Steffensen KR & Gustafsson J-Å 2004 Putative metabolic effects of the liver X receptor (LXR). Diabetes 53 Suppl 1 S36S42.
Stulnig TM, Oppermann U, Steffensen KR, Schuster GU & Gustafsson J-Å 2002a Liver X receptors downregulate 11 beta-hydroxysteroid dehydrogenase type 1 expression and activity. Diabetes 51 24262433.
Stulnig TM, Steffensen KR, Gao H, Reimers M, Dahlman-Wright K, Schuster GU & Gustafsson J-Å 2002b Novel roles of liver X receptors exposed by gene expression profiling in liver and adipose tissue. Molecular Pharmacology 62 12991305.
Tardiff J & Krauter KS 1998 Divergent expression of alpha1-protease inhibitor genes in mouse and human. Nucleic Acids Research 26 37943799.
Wagner BL, Valledor AF, Shao G, Daige CL, Bischoff ED, Petrowski M, Jepsen K, Baek SH, Heyman RA, Rosenfeld MG et al. 2003 Promoter-specific roles for liver X receptor/corepressor complexes in the regulation of ABCA1 and SREBP1 gene expression. Molecular and Cellular Biology 23 57805789.
Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA & Mangelsdorf DJ 1995 LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes and Development 9 10331045.
Yoshikawa T, Ide Ti, Shimano H, Yahagi N, Amemiya-Kudo M, Matsuzaka T, Yatoh S, Kitamine T, Okazaki H, Tamura Y et al. 2003 Cross-talk between peroxisome proliferator-activated receptor (PPAR) and liver X receptor (LXR) in nutritional regulation of fatty acid metabolism. I. PPARs suppress sterol regulatory element binding protein-1c promoter through inhibition of LXR signaling. Molecular Endocrinology 17 12401254.
Zhang Y, Repa JJ, Gauthier K & Mangelsdorf DJ 2001 Regulation of lipoprotein lipase by the oxysterol receptors, LXRalpha and LXRbeta. Journal of Biological Chemistry 276 4301843024.
Received 21 July 2004
Accepted 17 August 2004
This article has been cited by other articles:
![]() |
J. He, Q. Cheng, and W. Xie Minireview: Nuclear Receptor-Controlled Steroid Hormone Synthesis and Metabolism Mol. Endocrinol., January 1, 2010; 24(1): 11 - 21. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Kim, L. C. Andersson, D. Bouton, M. Warner, and J.-A. Gustafsson Stromal growth and epithelial cell proliferation in ventral prostates of liver X receptor knockout mice PNAS, January 13, 2009; 106(2): 558 - 563. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Fan, H.-J. Kim, D. Bouton, M. Warner, and J.-A. Gustafsson Expression of liver X receptor {beta} is essential for formation of superficial cortical layers and migration of later-born neurons PNAS, September 9, 2008; 105(36): 13445 - 13450. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Smoak, J. Madenspacher, S. Jeyaseelan, B. Williams, D. Dixon, K. R. Poch, J. A. Nick, G. S. Worthen, and M. B. Fessler Effects of Liver X Receptor Agonist Treatment on Pulmonary Inflammation and Host Defense J. Immunol., March 1, 2008; 180(5): 3305 - 3312. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Kim, X. Fan, C. Gabbi, K. Yakimchuk, P. Parini, M. Warner, and J.-A. Gustafsson Liver X receptor {beta} (LXR{beta}): A link between {beta}-sitosterol and amyotrophic lateral sclerosis-Parkinson's dementia PNAS, February 12, 2008; 105(6): 2094 - 2099. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nilsson, T. M. Stulnig, C.-Y. Lin, A. L. Yeo, P. Nowotny, E. T. Liu, and K. R. Steffensen Liver X Receptors Regulate Adrenal Steroidogenesis and Hypothalamic-Pituitary-Adrenal Feedback Mol. Endocrinol., January 1, 2007; 21(1): 126 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, A. H. Moser, J. K. Shigenaga, C. Grunfeld, and K. R. Feingold Downregulation of liver X receptor-{alpha} in mouse kidney and HK-2 proximal tubular cells by LPS and cytokines J. Lipid Res., November 1, 2005; 46(11): 2377 - 2387. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gerin, V. W. Dolinsky, J. G. Shackman, R. T. Kennedy, S.-H. Chiang, C. F. Burant, K. R. Steffensen, J.-A. Gustafsson, and O. A. MacDougald LXR{beta} Is Required for Adipocyte Growth, Glucose Homeostasis, and {beta} Cell Function J. Biol. Chem., June 17, 2005; 280(24): 23024 - 23031. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |