|
|
||||||||
gene is a target of the circadian clock pacemaker
Laboratoire de Biologie Moléculaire et Cellulaire, CNRS UMR 5161, Ecole Normale Supérieur de Lyon, 46 allée dItalie, 69364 Lyon cedex, France
1 Howard Hughes Medical Institute, Northwestern University, Department of Neurobiology and Physiology, 2205 Tech Drive, Evanston, IL 60208, USA
2 Laboratoire de Physiologie des Membranes Cellulaires, CNRS UMR 6078, Université de Nice-Sophia Antipolis, Chemin du Lazaret, 06 238 Villefranche-sur-mer, France
(Requests for offprints should be addressed to V Laudet; Email: Vincent.Laudet{at}ens-lyon.fr)
* (G Triqueneaux and S Thenot contributed equally to this work)
| Abstract |
|---|
|
|
|---|
is a ubiquitously expressed orphan nuclear receptor which functions as a constitutive transcriptional repressor and is expressed in vertebrates according to a robust circadian rhythm. We report here that two Rev-erb
mRNA isoforms, namely Rev-erb
1 and Rev-erb
2, are generated through alternative promoter usage and that both show a circadian expression pattern in an in vitro system using serum-shocked fibroblasts. Both promoter regions P1 (Rev-erb
1) and P2 (Rev-erb
2) contain several E-box DNA sequences which function as response elements for the core circadian-clock components: CLOCK and BMAL1. The CLOCKBMAL1 heterodimer stimulates the activity of both P1 and P2 promoters in transient transfection assay by 36-fold. This activation was inhibited by the overexpression of CRY1, a component of the negative limb of the circadian transcriptional loop. Critical E-box elements were mapped within both promoters. This regulation is conserved in vertebrates since we found that the CLOCKBMAL1 heterodimer also regulates the zebrafish Rev-erb
gene. In line with these data Rev-erb
circadian expression was strongly impaired in the livers of Clock mutant mice and in the pineal glands of zebrafish embryos treated with Clock and Bmal1 antisense oligonucleotides. Together these data demonstrate that CLOCK is a critical regulator of Rev-erb
circadian gene expression in evolutionarily distant vertebrates and suggest a role for Rev-erb
in the circadian clock output.
| Introduction |
|---|
|
|
|---|
Recently, genetic and biochemical approaches have identified genes that contribute to the generation of circadian rhythms in mammals as well as in Drosophila, zebrafish, Arabidopsis and Neurospora (Young & Kay 2001). The current model states that, in vertebrates, a transcriptional-translational feedback loop is established by the isochronal action of transcriptional regulators such as Period 13 (PER 13) and Cryptochrome 12 (CRY 12). These proteins enter the nucleus at a specific time of the day to block the interaction between the CLOCKBMAL1 and the MOP4BMAL1 heterodimers and their cognate E-box element, thereby interfering with the transcription of clock-regulated genes possibly by modifying histone acetylation (Chong et al. 2000, Lowrey & Takahashi 2000, Etchegaray et al. 2003). Several recent reports revealed the importance of the regulation of the nuclear entry of PER and CRY proteins. Indeed, it has been shown that phosphorylation by casein kinase I
and I
plays an important role in regulating the subcellular location and stability of these proteins (Lowrey & Takahashi 2000, Shearman et al. 2000, Lee et al. 2001, Vielhaber et al. 2001, Akashi et al. 2002, Yagita et al. 2002).
In mammals, the master clock controlling circadian rhythms resides in the suprachiasmatic nuclei (SCN) of the hypothalamus (reviewed in Ripperger and Schibler 2001). To keep pace with the solar day/night cycle, the master clock can be entrained by light received through photoreceptors in the retina (Foster 1998, Abe et al. 1999). Recent evidence, however, suggests that other endogenous oscillators independent of the central pacemaker in the SCN exist and are widespread in peripheral tissues in mammals, Drosophila and zebrafish (Tosini and Menaker 1996, Plautz et al. 1997, Whitmore et al. 1998, Yamakazi et al. 2000; reviewed by Brown and Schibler 1999). The ultimate proof of the existence of peripheral oscillators has been the demonstration that circadian rhythms of clock gene expression can be induced by a serum shock administered to serum-starved immortalized rat fibroblasts in culture (Balsalobre et al. 1998, Yagita et al. 2001). The existence of these peripheral clocks can be extended to embryos since early zebrafish embryos contain a circadian clock that can be reset by light (Delaunay et al. 2000). All these data suggest that most cells, if not all, may have a circadian clock. It is believed that the SCN clock entrains the phase of peripheral clocks via chemical cues, such as rhythmically secreted hormones. Furthermore, peripheral clocks can be regulated independently from the master clock since in rodents restricted feeding during the day can completely reverse the phase of circadian oscillators in the liver but has apparently no effect on the central oscillator in the SCN (Damiola et al. 2000, Stokkan et al. 2001).
Although the core molecular pacemaker generating circadian rhythm has been defined both in the SCN and peripheral organs, the molecular outputs that ultimately regulate circadian control of cellular physiology, organ function and behavior are poorly understood (Jin et al. 1999). Specifically, the link between circadian transcriptional output and physiology under circadian control is missing. To decipher how the circadian clock is able to control output pathways it is important to identify clock-controlled genes, i.e. genes that are under the direct transcriptional control of the CLOCKBMAL1 heterodimer.
Rev-erb
(NR1D1; Nuclear Receptors Nomenclature Committee 1999), a gene that encodes an orphan member of the nuclear receptor superfamily (Laudet & Gronnemeyer 2002) is a potential candidate as a clock-controlled gene. Indeed, we and others have shown that its expression exhibits a robust circadian rhythm in shocked fibroblasts or human hepatic cells, in rodent liver and also in zebrafish (Balsalobre et al. 1998, Delaunay et al. 2000, Torra et al. 2000, Grundschober et al. 2001). Rev-erb
appears particularly interesting as a putative clock-controlled gene because it was already known that its expression is under tight transcriptional control by a number of factors. The characterization of its promoter in humans lead to the demonstration that the expression of this gene is down-regulated by its own product, which behaves as a potent transcriptional repressor (Harding & Lazar 1995, Adelmant et al. 1996). In addition, human Rev-erb
promoter activity is inhibited by glucocorticoids (Torra et al. 2000) that are known to play an important role in the resetting of circadian time in peripheral tissues (Balsalobre et al. 2000). Finally, Rev-erb
expression is regulated by fibrates, hypolipidemic drugs that are ligands of the nuclear hormone receptor peroxisome proliferator-activated receptor
(PPAR
; Fruchart et al. 1999). Interestingly, PPAR
itself is expressed according to circadian rhythm (Lemberger et al. 1996), suggesting that the Rev-erb
gene can integrate several levels of regulation, both at the circadian and physiological levels. The link between Rev-erb
and circadian rhythm has been reinforced recently by the observation that Rev-erb
-deficient mice exhibit a circadian phenotype and that Rev-erb
controls the cyclic expression of Bmal1 (Preitner et al. 2002).
In this paper we report that the two promoters governing the expression of the Rev-erb
gene in mammals contain E-box DNA elements and generate circadian transcripts. We show that both promoters are activated by CLOCKBMAL1 heterodimers in transient transfections and that CLOCKBMAL1 heterodimers bind to E-box sequences and activate transcription through these E-boxes. Rev-erb
expression is strongly reduced in the livers of Clock mutant mice suggesting that the activation observed in transient transfections also occurs in vivo. In addition, we show that this regulation is evolutionarily conserved since CLOCKBMAL1 also regulates the expression of the zebrafish Rev-erb
gene. Taken together, these data demonstrate clearly that the Rev-erb
gene is a clock-controlled gene.
| Materials and methods |
|---|
|
|
|---|
All genomic Rev-erb
regions were subcloned in pGL2 luciferase reporter plasmids after PCR with oligonucleotides containing enzymatic restriction sites. The oligonucleotides were as follows. P1, including the E1A exon as a 1350 bp fragment: 124 MluI, 5'-ATTAACGCGTCTGCAGGGAG CAGACCCCCCTCTA-3', top strand; 13311350 XhoI, 5'-ATTACTCGAGCTGTGTTGTTGTT GGAGTCTAG-3', bottom strand. P2, including exon E1B as a 1852 bp fragment: 13531375 KpnI, 5'-ATTAGGTACCGTACTGAGATTCT TATCTTTGCT-3', top strand; 39203942 XhoI, 5'-ATTACTCGAGCTAGGAAGAGAGCACGA GGGGAG-3', bottom strand. P1+P2 as a 3142 bp fragment: 124 MluI and 39203942 XhoI.
Deletion constructs in P1 were generated by PCR using the following oligonucleotides. D400-P1-Luc: 458478 KpnI, 5'-ATTAAGGTACCCC AGGAATTCACATGCCCTTG-3', top strand, and the 13311350 XhoI oligonucleotide for the bottom strand. Mutations of a1 and a2 sites in the P1 promoter were produced by PCR using the following oligonucleotides. a1*D400-P1-Luc: a1*458478 KpnI, 5'-ATTAAGGTACCCCAGG AATTCACGGGCCCTTG-3', top strand, and the 13311350 XhoI oligonucleotide for the bottom strand. a2*-P1-Luc: 124 MluI as top strand with a2*709732 KpnI, 5'-ATTAGGTACCATTGAA TTCCAGGGAGCG-3', bottom strand. Subsequently, PCR products were ligated into P1 at the KpnI site. Each construct was sequenced on both strands.
Three deletion constructs of the P2 promoter were generated: DistalP2-Luc, D800-P2-Luc and ProximalP2-Luc. The DistalP2-Luc region was obtained by PCR with the 13531375 KpnI oligonucleotide, top strand, and the 22152190 HindIII oligonucleotide, bottom strand, 5'-ATT AAAGCTTTGCCCCTCGCACGTGGCACC-3'. The D800-P2-Luc region was obtained by PCR amplification using a 21963218 KpnI, 5'-ATTA AGGTACCGATCCTCGTTGGGGTGCCACG T-3'oligonucleotide, top strand, and a 39203942 XhoI oligonucleotide as bottom strand. The resulting PCR fragments were cloned in pGL2 vector and sequenced. The proximal P2 region was generated by enzymatic digestion of the P2-Luc vector with SmaI and PvuII before ligation.
The positive control vector (Per1E)3-Luc was generated by ligation in triplicate of the following oligonucleotide: 5'-AGATCCAAGTCCACGTG CAGGGC-3' harboring the mPer1 E-box sequence, upstream of a synthetic TATA-box oligonucleotide (5'-AGATCTGCATCGGGTATA TAATAA-3'). The whole fragment was cloned as a XhoIHindIII fragment in the pGL2 vector. An E-box-mutated version of this oligonucleotide (5'-AGATCCAAGTCCAATTGCAGGGC-3') was used to generate the negative control vector (Per1Em)3-Luc.
Expression vectors were designed as follows: the coding region of mouse Cry1 was obtained by reverse transcriptase (RT)-PCR using the following oligonucleotides: top strand, 5'-GATCAAGCTT ACCATGGACTACAAGGACGAC-3'; bottom strand, 5'-CCAGCCTCCTTGGCCATCTTC AT-3'. The PCR product was cloned in the pCDNA3 vector and sequenced.
Expression vectors for the mouse Clock was provided by J S T and the human BMAL1 generously provided by M Ikeda (Waseda University, Tokyo, Japan). For all vectors, PCR amplifications of cDNA were performed to replace the natural ATG by a consensus Kozak sequence to ensure translation with high yield. For this, oligonucleotides containing an efficient Kozak sequence (ACC) upstream of the ATG were used as 5' primers and a 20 bp antisense oligonucleotide overlapping the stop codon as the 3' primer. Oligonucleotides are available from G T upon request. The ß-gal expression vector was constructed from the pCMV-SPORT-ßgal vector (Life Technologies, Cergy Pontoise, France) by cloning an ApaIKpnI fragment containing the entire open reading frame into the pCDNA3 vector.
Zebrafish Rev-erb
promoter fragments were obtained by PCR amplification on a genomic DNA clone (isolated from a Danio rerio DNA library) and subcloned into a pGL3 vector. The oligonucleotides were as follows. For the 3.2 kb promoter long fragment A: top strand, 5'-GAGAGCTCGC GGCCGCGAGCTC-3'; bottom strand, 5'-TCG AAGCTTCGCACCAAATACGTGCGC-3'. The resulting PCR product was cut by SalI and HindIII restriction enzymes and subcloned into XhoIHindIII-digested pGL3 vector. For the 1.4 kb promoter long fragment B and the 0.4 kb promoter short fragment C: top strand (B fragment), 5'-GATGAGCTCCGAGGTAAATATCACCAC-3'; top strand (C fragment), 5'-GATGAGCTCC TCTTTGACTTCGACTAC-3'; bottom strand (B and C fragments), 5'-TCGGGATCCCGCACC AAATACGTGCGC-3'. The resulting PCR products were digested by SacI and BamHI restriction enzymes and subcloned into SacIBglII-digested pGL3 vector.
Mutated sites of E-boxes were generated using two successive PCRs with the following oligonucleotides. Top strand E-box (ZFg1), 5'-TCAGGTG GACAATTGCGCGGGGGT-3'; bottom strand E-box(ZFg1), 5'-ACCCCCGCGCAATTGTCCA CCTGA-3'; top strand E-box(Zfa), 5'-AGTCGGG TCCATAGGACACATTT-3'; bottom strand E-box(Zfa), 5'-AAATGTGTCCTATGGACCCG ACT-3'.
Accession numbers for Rev-erb
genomic sequences are: AY336123
[GenBank]
, AY336124
[GenBank]
, AY336125
[GenBank]
and AY336126
[GenBank]
for human, mouse, rat and zebrafish species respectively.
Transient transfections and reporter assays in mammalian cells
Cos1, Ros17.2/8, 3Y1 and Rat-1 cells were maintained in Dulbeccos modified Eagles medium (DMEM; Invitrogen) supplemented with 5% fetal calf serum and 100 U/ml penicillin/streptomycin. Typically, 40 ng of the reporter vectors were cotransfected with 100 ng of each expression vector in 12-well plates. When necessary, the final DNA concentration was adjusted to 240 ng with the pCDNA3-ßgal vector. Transfection was achieved using 2.5 x 104 cells in 0.5% fetal calf serum with 2 µl Exgen 500 transfection reagent (Euromedex, Souffelweyersheim, France) mixed with plasmids in 100 µl DMEM, according to the manufacturers protocol. Then, 48 h after transfection, cells were lysed in 200 µl 1 x harvest buffer (50 mM Tris, pH 7.8, 1 mM dithiothreitol, 0.1% Triton X-100) on ice. Cell lysates were vortexed briefly, and cellular debris was pelleted by centrifugation. Then 50 µl lysate were mixed with 100 µl luciferase-assay cocktail containing 1 mM luciferin. Luciferase activity was measured in a Monolight 2010 luminometer (Analytical Luminescence Laboratory, Sparks, MD, USA).
To study CRY1 inhibition, 100 ng Clock and 100 ng Bmal1 expression vectors were cotransfected with pCDNA3-Cry1 vector and, when necessary, the pCDNA3-ßgal vector, to adjust the DNA total amount.
Northern blots
Total RNA was extracted from the livers of Clock mutant or wild-type mice housed in constant darkness and killed at various circadian times. Ten µg were loaded and migrated on a 1% agarose gel. Hybridization was performed overnight in 50% formamide, 5 x SSPE, 1x Denhardts solution, 0.1% SDS and 0.1 mg/ml denatured salmon-sperm DNA at 63 °C. The Rev-erb
probe used was the 230 bp fragment used in the RNase protection assay. Washing was carried out in 0.5 x SSPE/0.1% SDS at 65 °C for 30 min.
Semi-quantitative RT-PCR analysis
Semi-quantitative PCR analyses were performed on RNA extracted from serum-shocked fibroblasts. RNAs were extracted using the Sigma GenElute Mammalian Total RNA Kit with 250 µl lysis buffer per well for cells cultivated in 12-well plates according to the manufacturers protocol. One-tenth of the extracted RNA was reverse-transcribed with avian myeloblastosis virus RT (Promega) at 42 °C for 1 h. 12 µl of the reverse-transcribed RNA was used for the PCR reaction with 200 ng primers, 2.5 mM Mg2+ and 1.5 U Taq Gold polymerase with appropriate buffer (Perkin-Elmer) in a final volume of 30 µl. For each gene analyzed, three different numbers of cycles were tested to reach linear phase in PCR reactions (see number of cycles on Fig. 2
). PCR cycles were as follows: 94 °C for 5 min, 94 °C for 30 s, 57 °C for 40 s, 72 °C for 30 s and a final extension of 72 °C for 5 min. The oligonucleotides used for the PCR were as follows. Rev-erb
: E1A 5'-GGCTTCACTCGTCTCTCT CAGCC-3', top strand; E1B 5'-TGAGTCTTAT CTCCATATCACA-3', top strand; E2 5'-GCAC AGTGCCAAATGAGCGGGC-3', bottom strand. Per1: 5'-ATGACTGGGGCAGAGGTTGAGCC TG-3', top strand; 5'-TCATGCTTAGATCGTG AAATAGGG-3', bottom strand. Per3: 5'-ATGA CATACCAGGTGCCGGAGAGG-3', top strand; 5'-CTTCTGCAGTGTCACCAACTGAAC-3', bottom strand. Cry1: 5'-CAGCAAAATGGAGC CCCTGG-3', top strand; 5'-CACACCGCAGAG GACAAGCC-3', bottom strand. Clock: 5'-GCG AGAACTTGGCATTGAAGAG-3', top strand; 5'-TTTGCAGCTTGAGACATCGCTGGC-3', bottom strand. 28S: 5'-GTGAAAGCGGGGCCT CACGATCC-3', top strand; 5'-GTACTGAGCA GGATTACCATGGC-3', bottom strand.
|
-32P]dATP. Washing was carried out in 0.5x SSPE/0.1% SDS at 30 or 37 °C for 20 min depending on the length of the oligonucleotide used. The oligonucleotides used as probes were all designed within the PCR fragment and were as follows. Rev-erb
in E2, 5'-CACCTACATTGGCTCCAGCGGATCCT CCC-3'; Per1, 5'-TGCTGAAGTAGAGCCTGAA GTTC-3'; Per3, 5'-ATGACATACCAGGTGCC GGAGAGG-3'; Cry1, 5'-GACGTGATAGGGAA GTGCAC-3'; Clock, 5'-CAGTTTTCAGCTCA GTTAGGAGCC-3'; 28S, 5'-GGGATAACTGG CTTGTGGCGGCCAAGCG-3'. Serum-shock treatment
Circadian induction of 3Y1 or Rat-1 fibroblasts was performed on 7-day-confluent cells, maintained in starvation conditions in 12-well plates before being shocked. At T0, 50% horse serum was added to the cells for 2 h. The cells were then grown in DMEM without serum for 2 days and harvested at various circadian times.
Electrophoretic mobility shift assays (EMSAs)
CLOCK and BMAL1 proteins were synthesized in vitro using the TNT T7 Coupled Reticulocyte Lysate System (Promega) according to the manufacturers instructions. The two proteins were synthesized separately and mixed during the EMSA.
In other cases, either crude nuclear extracts of mouse fibroblast STO cells or nuclear extracts of STO cells transfected with Clock and Bmal1 expression vectors were used. All nuclear extracts were prepared using kit from Active Motif Europe (Rixensart, Belgium) according to the suppliers protocol.
EMSAs were performed according to Vanacker et al.(1999) with the following modifications: 2 µl aliquots of each specific TNT reaction mixture were mixed with 20 fmol of acrylamide-purified, double-stranded DNA labeled probe in the presence or absence of the competitor and incubated for 30 min at 30 °C in incubation buffer (20 mM Tris-HCl, 50 mM NaCl, 5% glycerol, 5 mM magnesium sulfate, 1 µg poly(dIdC).poly-(dIdC) and 1 mM dithiothreitol). The mixture was then loaded on to a 5% polyacrylamide gel.
The oligonucleotides used for EMSA were as follows. mPer1 E-box: 5'-GATCCAGCACCCAA GTCCACGTGCAGGGATGTGTGA-3',top strand; 5'-GATCTCACACATCCCTGCACGTG GACTTGGGTGCTG-3', bottom strand. g1: 5'-GATCCCAGTTCTGCAATCACGTGAAGCTC TCACGTA-3', top strand; 5'-GATCTACGTG AGAGCTTCACGTGATTGCAGAACTGG-3', bottom strand. g2: 5'-GATCCCAGAGCCGGGC CCACGTGCTGCATTTGTTTA-3', top strand; 5'-GATCTAAACAAATGCAGCACGTGGGCC CGGCTCTGG-3', bottom strand. g3: 5'-GATC CTCGTTGGGGTGCCACGTGCGAGGGGCA CACA-3', top strand; 5'-GATCTGTGTGCCC CTCGCACGTGGCACCCCAACGAG-3', bottom strand. g4: 5'-GATCCGTGCGAGGGGCAC ACGTGGAGCGGGGACGTA-3', top strand; 5'-GATCTACGTCCCCGCTCCACGTGTGCCC CTCGCACG-3', bottom strand. g5: 5'-GATC CTGTCAGCTCCCACACGTGTCTGGGGATC CTA-3', top strand; 5'-GATCTAGGATCCCC AGACACGTGTGGGAGCTGACAG-3', bottom strand. g3+4: 5'-GATCCTCGTTGGGGTGCCA CGTGCGAGGGGCACACGTGGAGCGGGGA CGTGA-3', top strand; 5'-GTACTACGTCCC CGCTCCACGTGTGCCCCTCGCACGTGGC ACCCCAACGAG-3', bottom strand. a1: 5'-GA TCCTCCCCAGGAATTCACATGCCCTTGCC ATACA-3', top strand; 5'-GATCTGTATGGCAA GGGCATGTGAATTCCTGGGGAG-3', bottom strand. a2: 5'-GATCCGCTCCCTGGAATCAC ATGGTACCTGCTCCAA-3', top strand; 5'-GA TCTTGGAGCAGGTACCATGTGATTCCAGG GAGCG-3', bottom strand. a3: 5'-GATCCCCG GGAAGGGCTCACATGGCTGCAGAGCCGA -3', top strand; 5'-GATCTCGGCTCTGCAGCC ATGTGAGCCCTTCCCGGG-3', bottom strand.
Mutated versions of the E-box elements were obtained by substitution of two bases inside the core sequence (CACGTG to CAATTG, or CAC ATG to CCATAG) in all the relevant oligonucleotides. a2 g and Per1a substitutions were obtained with oligonucleotides bearing a CACGTG and a CACATG respectively. ZFg1, 5'-TCAGGTGGA CACGTGCGCGGGGGT-3' E-box (G), top strand; ZFg1, 5'-ACCCCCGCGCACGTGTCCA CCTGA-3' E-box (G), bottom strand. ZFg1*, 5'-TCAGGTGGACAATTGCGCGGGGGT-3' E-box (mutant), top strand; ZFg1*, 5'-ACCCCC GCGCAATTGTCCACCTGA-3' E-box (mutant), bottom strand. ZFa, 5'-AGTCGGGTCACATG GACACATTT-3' E-box (A), top strand; ZFa, 5'-AAATGTGTCCATGTGACCCGACT-3' E-box (A), bottom strand. ZFa*, 5'-AGTCGGG TCCATAGGACACATTT-3' E-box (A), top strand; ZFa*, 5'-AAATGTGTCCTATGGACCC GACT-3' E-box (A), bottom strand.
Quantitative (Q)-PCR experiments
To verify the semi-quantitative PCR and to complete the analysis of Rev-erb
isoforms, Q-PCR was performed with the ABI Prism SYBR Green Reagents (Applied Biosystems, Courtaboeuf, France). cDNAs were synthesized by reverse transcription as below. Samples contained 1x SYBR Green Master Mix, 0.5 µM primers and 1/40 synthesized cDNA in a 25 µl final volume. PCR conditions were as follows: 10 min at 95 °C, then 50 cycles of 15 s at 95 °C, 60 s at 60 °C and a final elongation cycle of 1 min at 60 °C. Absolute abundance of cDNA was calculated using the standard curve obtained with the two ranges done by serial dilutions from pure to 1/64. For the 28S RT products were diluted 1/300 before use.
Oligonucleotides used for rat samples were as follows. E1A top strand, 5'-CACGGGGCGAGA GAGGGCACC-3'; E1B top strand, 5'-TGAG TCTTATCTCCATATCACA-3'; E2 bottom strand, 5'-GAAGGGGAGCTATCATCACTG-3'; 28S top strand, 5'-GTGAAAGCGGGGCCTCA CGATCC-3'; 28S bottom strand, 5'-GTACT GAGCAGGATTACCATGGC-3'; Per1 top strand, 5'-ATGACTGGGGCAGAGGTTGAGC CTG-3'; Per1 bottom strand, 5'-TCATGCTT AGATCGTGAAATAGGG-3'. Cry1, 5'-CAGCA AAATGGAGCCCCTGG-3', top strand; 5'-CAC ACCGCAGAGGACAAGCC-3', bottom strand. Oligonucleotides used for mouse samples were as follows. E1A top strand, 5'-CAGGGGGCGAGA GAGGCCATCAC-3'; E1B top strand, 5'-AGG AAGGGGAATTCCTAAATCCC-3'; E2 bottom strand, 5'-GGCGCACTGCCAAAAGAGCGG GC-3'; 28S oligonucleotides were the same as for rat experiments.
RNA in situ hybridization
Zebrafish (Danio rerio) were kept at 28.5 °C in a 14-h light/10-h dark cycle. Embryos were collected after spawning to perform the morpholino injection. To prevent pigmentation, 0.2 mM 1-phenyl-2-thiourea (Sigma) was added to the water at 12 h post-fertilization. At 48 h post-fertilization, embryos were fixed in 4% paraformaldehyde in PBS overnight at 4 °C. Whole-mount in situ hybridization was perfomed using antisense digoxigenin-labeled Rev-erb
probe and embryos were incubated at 70 °C in a 50% formamide hybridization solution. Probes were detected using alkaline phosphatase-conjugated antibodies and visualized by 4-Nitro Blue Tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate staining (for a protocol reference, see Thisse et al. 1993).
Morpholinos
We obtained morpholinos from GeneTools (Philomath, OR, USA). The morpholinos sequences were as follows: clock1, 5'-CATCCCGG TCTATGCTGGAGGTCAT-3'; clock2, 5'-GAT AACTCGGTCTCATGGATCAGTC-3'; bmal1, 5'-TATCCATTCTTTGGTCTGCCATTAG-3'; bmal2, 5'-CAGATTTCATTTCCAGGTTGTC CAT-3'. For the control, we used standard control morpholino provided by GeneTools: 5'-CCUCUU ACCUCAGUUACAAUUUAUA-3'. We injected wild-type embryos at the onetwo cell stage with 12 µl morpholino in 1 x Danio buffer at 0.25 or 0.5 mg/ml.
| Results |
|---|
|
|
|---|
isoforms
The human and rat Rev-erb
genes generate two mRNA isoforms, Rev-erb
1 and Rev-erb
2, with different 5' regions (Lazar et al. 1989, Miyajima et al. 1989, Laudet et al. 1991, Dumas et al. 1994, G T Triqueneaux, B Staels & V L Laudet, unpublished observations; see Fig. 1
). The resulting proteins differ only in their N-terminal A/B domain. The long isoform, Rev-erb
1, is generated from the P1 promoter located upstream of exon E1A which contains a start codon (Adelmant et al. 1996). The short isoform Rev-erb
2 is expressed at lower levels and can be generated from a newly identified promoter called P2 located upstream of the non-coding exon E1B (G T Triqueneaux, B Staels & V L Laudet, unpublished observations; see supplementary Fig. 1
at http://jme.endocrinology-journals.org/content/vol33/issue3/). This exon is spliced to exon 2, which contains an in-frame start codon. Of note, the transcripts generated at P1 can encode the two protein isoforms by alternative start-codon usage. The relative importance of the two mechanisms (alternative promoter usage and splicing or alternative start-codon selection) used to generate Rev-erb
1 and Rev-erb
2 is, at present, unknown.
|
gene expression has been shown to be under circadian regulation in vivo and in serum-shocked tissue-culture cells (Balsalobre et al. 1998, Delaunay et al. 2000, Torra et al. 2000, Grundschober et al. 2001). We observed this rhythmic expression in serum-shocked Rat-1 or 3Y1 rat fibroblasts using a strategy that did not discriminate between the two Rev-erb
isoforms (Fig. 2A
1 and Rev-erb
2 was circadian, we designed a Q-PCR-based assay using isoform-specific primers for exon 1 (Figs 1
1 isoform using an antibody directed against the ligand binding domain (LBD) (from N Preitner, Department of Molecular Biology, NCCR Frontiers of Genetics, Sciences II, University of Geneva, Switzerland; see supplementary Fig. 2A
transcripts is compatible with a down-regulation of Rev-erb
by the negative components of the circadian clock, PER and CRY.
Rev-erb
P1 and P2 promoters contain circadian clock-response elements
The circadian regulation of P1 and P2 prompted us to search within these promoter regions for E-box sequences, which are known response elements for the circadian transcriptional activating heterodimer CLOCKBMAL1 (Gekakis et al. 1998). Comparative analysis of the human, rat (Rattus norvegicus) and mouse (Mus musculus) P1 promoters revealed one canonical E-box element (CACGTG; g1 in Fig. 3A
) and two divergent E-boxes (CACATG; a1 and a2). We also found three conserved canonical E-boxes (g2, g3 and g4 in Fig. 3A
) and one divergent E-box (a3) in the human and rat P2 region. These E-boxes were also conserved in the mouse P2 promoter (results not shown). An additional canonical E-box (g5) was found only in the rodent promoters instead of a divergent one in human (a4).
|
E-boxes contain flanking sequences that are reminiscent of those circadian E-boxes with a pyrimidine base at position 1 and, a G at 3 and often a C at position +10 (Fig. 3B
promoters contain all the necessary DNA elements required for a regulation by CLOCKBMAL1 and these elements are conserved in mammals.
The CLOCKBMAL1 heterodimer regulates Rev-erb
promoters
We next explored whether the CLOCKBMAL1 heterodimer was able to activate P1, P2 or a construct containing P1+P2 in transient co-transfection assays. Since CLOCKBMAL1 activity was shown to be tissue-specific in certain cases (Chen & Baler 2000), we performed these experiments in three different cell lines: Cos-1 cells, human osteosarcoma Ros17.2/8 cells and rat fibroblastic 3Y1 cells. As a positive control we used a construct in which we cloned three canonical E-boxes derived from the mouse Per1 promoter upstream of a TATA box and the luciferase gene to generate the (Per1E)3-Luc construct. The mutated version of these E-boxes from this construct give rise to (Per1Em)3-Luc, which was used as a negative control. In all three cell lines the CLOCKBMAL1 heterodimer activated the (Per1E)3-Luc construct between 4- and 6-fold and was inactive on the mutated version (Fig. 4A
). CLOCK alone or BMAL1 alone didnt affect the promoter activity (supplementary Fig. 3
). Interestingly, CLOCKBMAL1 was able to activate 35-fold the activity of P1, P2 or P1+P2 in the three different cell lines (Fig. 4A
). The association of P1 and P2 in the same vector did not confer an increased sensitivity to CLOCKBMAL1.
|
isoforms.
The CLOCKBMAL1 heterodimer binds to and transactivates Rev-erb
E-box elements
To map the regions involved in CLOCKBMAL1 binding and trans-activation, we designed a series of P1 and P2 deletion constructs that were all tested for their ability to be activated by CLOCKBMAL1 in transient assay in Cos-1 cells.
Deletion of the canonical E-box (g1) from P1 sequence (D400-P1-Luc construct) decreased but did not abolish its ability to be activated by CLOCKBMAL1 (Fig. 5A
), most likely due to the presence of two divergent CACATG E-boxes (a1 and a2). Trans-activation was not affected by introducing the mutation into a1 E-boxes (a1*D400-P1-Luc construct), strongly suggesting a critical role for the a2 site in P1 circadian regulation. This site also corresponds to the major transcriptional start site of the human P1 promoter (Adelmant et al. 1996) but to a minor one in rat (results not shown). Mutation of this site (a2*-P1-Luc construct) in the context of the complete P1 promoter totally abolished CLOCKBMAL1 activation but not the basal activity of the promoter (Fig. 5B
). These data indicate that CLOCKBMAL1 activates the P1 promoter through the a2 site.
|
To determine whether the CLOCK and BMAL1 proteins were able to bind the identified Rev-erb
E-boxes, we set up a gel-shift assay using in vitro-translated proteins and the mouse Per1 proximal promoter E-box sequence as a probe together with competitor oligonucleotides corresponding to each of the Rev-erb
E-boxes. As expected, the CLOCKBMAL1 heterodimer bound strongly to the mPer1 E-box probe (Fig. 6A
). This binding is reduced by adding a molar excess of unlabeled mPer1 E-box but not by the mutated version of the Per1 E-box (Per1*). Surprisingly, g1 site, which was not sufficient for CLOCKBMAL1 activation of the P1 promoter in our transient transfection experiments, competed strongly with CLOCKBMAL1 binding to the mPer1 E-box. When using the a1 site-specific oligonucleotide as a probe, we observed very weak, if any, binding of CLOCKBMAL1 consistent with the fact that mutation of this site does not modify CLOCKBMAL1 activation of the Rev-erb
gene (Fig. 6B
, left-hand panel). In contrast, we detected a specific, albeit weak, binding of CLOCKBMAL1 using the a2 probe (Fig. 6B
, middle panel). We then performed similar gel-shift assay (Fig. 6C
) using nuclear extracts of mouse STO fibroblasts in which the CLOCK and BMAL1 proteins were transiently expressed. If BMAL1 alone only marginally affected the amount of the shifted complex, the overexpression of CLOCK increased the binding strongly, suggesting that endogenous CLOCK is a limiting factor in the crude nuclear extract. As shown in Fig. 6C
, CLOCKBMAL1 binding to an a2-specific probe was strongly reduced by addition of an a2 unlabeled competitor but not by an unrelated oligonucleotide or by the mutated a2 site (a2*; results not shown).
|
Since in P1 the main E-box responsible for CLOCKBMAL1 activation is the divergent CACATG E-box (a2), we decided to study in more detail the importance of the core sequence of the E-box compared to the adjacent sequences. As shown in Fig. 7
, using crude nuclear extracts of STO fibroblasts we obtained a specific retarded complex at the same level as the bona fide CLOCKBMAL1 complex with the divergent a2 E-box probe (Fig. 6C
), as well as the canonical CACGTG E-box from Per1 promoter. The complex was competed out by an excess of specific competitors but not by unrelated sequences (see Fig. 7
, lanes 14 and 15) or by the mutated version of the probes (a2* and Per1*; see Fig. 7
, lanes 6, 7, 12 and 13). In all cases, it is clear that the a2 unlabeled competitor was more efficient at decreasing the binding than the Per1 unlabeled competitor (compare lanes 2 and 3 with lanes 8 and 9 on Fig. 7A and B
). Interestingly, when we replaced the core sequence CACATG of the a2 site with a canonical CACGTG (a2 g element) we observed that the resulting sequence competed equally well for the binding to either the a2 or the Per1 probe (see Fig. 7A
, lanes 4 and 5 and Fig. 7B
, lanes 10 and 11). This was not the case when the Per1 canonical sequence was mutated to a CACATG-type element (Per1a) since this sequence competed poorly for the binding to the a2 probe (Fig. 7A
, lanes 10 and 11) and only moderately for the binding to the Per1 probe (Fig. 7B
, lanes 4 and 5). All these data clearly suggest that the context of the E-box is important for CLOCKBMAL1 binding: the adjacent positions allow the divergent a2 element to bind CLOCKBMAL1 whereas the context is less important for canonical E-boxes.
|
is a target gene of Clock in vivo
If Rev-erb
is a target of the circadian pacemaker as suggested by our transfection and gel-shift data, then an alteration of the circadian clock function should impair Rev-erb
gene expression. To address this question, we first compared Rev-erb
circadian gene expression profiles in the livers of wild-type and Clock mutant mice. Clock mutant mice express a dominant-negative version of CLOCK, which is defective in transactivation (King et al. 1997, Gekakis et al. 1998). At the behavioral level, they exhibit lengthening of an endogenous period followed by complete arhythmicity after long exposure to constant darkness conditions (Vitaterna et al. 1994). Northern blot analysis of Rev-erb
expression levels in wild-type and Clock mutant mice kept under conditions of constant darkness was performed using total RNA samples extracted from livers collected at 4-h intervals during the third cycle of constant darkness. In the livers of wild-type mice Rev-erb
transcript demonstrates robust oscillation with a peak of expression occuring at 66 h of constant darkness, which corresponds to circadian time (CT) 6 (Fig. 8A
). In contrast, mutant mice maintained under the same conditions showed a marked decrease of Rev-erb
expression level with significantly reduced amplitude and the phase of expression delayed by approximately 8 h. Therefore, this experiment indicates that Rev-erb
is a target gene of CLOCK in vivo.
|
promoters are direct targets of CLOCKBMAL1, we checked whether the circadian expression of the transcripts emanating from each promoter was altered in Clock mice. Using Q-PCR analysis we observed that the transcripts starting at P1 as well as those from P2 are altered in the Clock mice suggesting that the two promoters are regulated independently by CLOCKBMAL1 (Fig. 8B
expression is under the control of the Clock gene and that the Rev-erb
gene is a Clock-controlled gene.
The zebrafish Rev-erb
gene is also a Clock-controlled gene
We observed previously that Rev-erb
expression is circadian in zebrafish, as it is in mammals (Delaunay et al. 2000). To determine if Rev-erb
is regulated by the CLOCKBMAL1 heterodimer in zebrafish, we isolated 3.2 kb of the 5' flanking region of the zebrafish Rev-erb
gene. Interestingly, just upstream of exon 1, we noticed a region harboring 61% sequence identity with rat P1 promoter over 165 bp (Fig. 9A
). Of note, this region contains two E-boxes, one of which appears to be homologous to the a2 E-box. The other one is a canonical E-box that is not present in rat or human. In addition, we observed that three canonical E-boxes are present in the 5' region of the 3.2 kb P1 region (Fig. 9A
). Between exon 1 and 2 we did not find any exon reminiscent of exon 1B that may be under the control of a specific promoter.
|
upstream sequence (construct A) clearly exhibited a promoter activity and was activated 34-fold by co-transfection of the Clock and Bmal1 expression vectors (Fig. 9B
To provide an independent confirmation of the relevance of these data in vivo, we used morpholinos (Nasevicius & Ekker 2000) to knock-down the expression of either CLOCK or BMAL1 proteins during zebrafish embryogenesis. Due to extensive gene duplication, the zebrafish genome contains at least two Clock genes and two Bmal1 genes (F Delaunay & V Laudet, unpublished observations), we decided to co-inject two morpholinos able to block the protein synthesis of both genes (results not shown). We checked that these morpholinos effectively block the translation of the relevant protein in an in vitro expression system. In zebrafish, Rev-erb
is expressed specifically in the pineal gland at 48 h of development (Fig. 9D
; Delaunay et al. 2000). Interestingly, the injection of a control morpholino at the one-cell stage did not modify this expression (Fig. 9D
). In contrast, the injection of morpholinos that blocked either Clock or Bmal1 mRNA translation strongly decreased the expression of the endogenous Rev-erb
in the pineal gland at 48 h post-fertilization. The effect of these morpholinos was specific since they did not affect the expression of Otx5, a gene that is not circadian in the pineal gland (Fig. 9D
; Gamse et al. 2002). Taken together these data are in accordance with those obtained using the Clock mutant mice and suggest that in vivo the Clock and Bmal1 genes regulate Rev-erb
expression effectively.
| Discussion |
|---|
|
|
|---|
isoforms are under circadian regulation
Rev-erb
is an orphan nuclear hormone receptor that was cloned more than 10 years ago in several mammalian species and for which no well-defined physiological role has been found (reviewed in Laudet & Gronemeyer 2000). Importantly, this receptor lacks the C-terminal AF2 domain that is required for nuclear receptor ligand-dependent transcriptional activation and consequently behaves as a constitutive repressor. This suggests that Rev-erb
may be a true orphan receptor, the activity of which might be regulated through mechanisms other than ligand (Renaud et al. 2000). In this study, we show that the Rev-erb
gene encodes two transcripts, namely Rev-erb
1 and Rev-erb
2, that differ only in their 5' region and which are both regulated in a circadian manner. Our functional data suggest that the short Rev-erb
2 isoform is generated from an internal promoter located in the first intron. This finding suggests that these two Rev-erb
isoforms could repress the transcription of target genes in a manner dependent on the time of day and independent of ligand. N-terminus isoforms are commonly found within the nuclear receptor superfamilly and they have been shown, in some instances, to result in proteins with different target gene specificity (for examples see Mulac-Jericevic et al. 2000 and Laudet & Gronemeyer 2002).
The circadian regulation of Rev-erb
could be controlled at either the transcriptional or post-transcriptional levels. However, since this rhythmic expression was observed in serum-shocked fibro-blasts, an in vitro system, which mimicks in vivo free-running conditions (Balsalobre et al. 1998, Grundschober et al. 2001), we hypothesize that it is under the transcriptional control of the circadian clock pacemaker. In addition, analysis of the rat and human Rev-erb
5' flanking regions revealed several E-box DNA motifs, which are circadian system-response elements. Our paper presents two main lines of evidence strongly suggesting that the Rev-erb
gene is effectively under direct control of CLOCK and BMAL1: (1) functional data showing that the Rev-erb
promoters are activated by the CLOCKBMAL1 heterodimer through binding to specific E-boxes in mammals as well as in zebrafish and (2) genetic evidence showing that Rev-erb
expression is decreased and the amplitude of its rhythmic expression severely affected in Clock mutant mice, as well as zebrafish embryos injected with CLOCK or BMAL1 morpholinos.
Rev-erb
is a target of the circadian pacemaker
The phase of Rev-erb
circadian expression both in vivo and in serum-shocked fibroblasts is consistent with control of this gene by the circadian oscillator. CLOCK and BMAL1 protein expression cycle with peak values at CT21CT3 and a minimal value at CT6CT12 in mouse liver (Lee et al. 2001). This expression pattern is exactly antiphasic to PER1, PER2, CRY1 and CRY2 expression as well as that of Rev-erb
, which peaks in the liver at CT8 (Balsalobre et al. 1998, Oishi et al. 1998, Torra et al. 2000). Interestingly, the pattern of Per2, Per3, Rev-erb
and Clock rhythmic expression is inverted in zebrafish when compared with nocturnal rodents but the relative phases are identical (Whitmore et al. 1998, Delaunay et al. 2000, 2003). Together, these expression data are strongly suggestive of an activation of Rev-erb
expression by the positive limb of the clock (CLOCKBMAL1 heterodimer) and a repression by the negative limb including the PER and CRY proteins. Indeed, it has recently been shown that the phase of Rev-erb
mRNA accumulation is considerably advanced in Per2Brdm1 mutant mice (Preitner et al. 2002). This observation is further supported by the near-complete loss of Rev-erb
circadian expression in Clock mice livers and in anti-CLOCK morpholino-treated and serum-shocked fibroblasts. These experiments provide the genetic evidence that Rev-erb
is an output of the circadian clock system. Because Rev-erb
is a transcriptional regulator, it is likely to act as a molecular link between the circadian oscillator and downstream target genes. For instance, Rev-erb
has been shown to bind to the promoter of the cellular retinol-binding protein I (CRBP1) for which mRNA circadian oscillation in the mouse liver has been described (Harding et al. 1995, Zheng et al. 2001). In addition, a direct role of Rev-erb
in the circadian pacemaker, at least in part through repression of Bmal1 gene expression, has been proposed recently (Preitner et al. 2002).
Our functional data strongly suggest that the CLOCKBMAL1 heterodimer controls Rev-erb
expression directly. Both promoters were activated by CLOCKBMAL1 and this activation was abolished by CRY protein. Interestingly, deletion and mutation analysis pointed to a divergent CACATG E-box in the P1 promoter, which is located in one of the transcription initiation sites of this promoter (Adelmant et al. 1996). In the P2 promoter, a complex of four E-boxes have been found (three canonical and one divergent) to respond to CLOCKBMAL1. Gel-shift assays clearly showed that all these elements, including the divergent E-boxes, were bound by CLOCKBMAL1. Interestingly, such divergent E-boxes have already been identified in the regulatory region of the liver transcription factor albumin-D site-binding protein (DBP) and they were shown to be recognized by CLOCKBMAL1 (Ripperger et al. 2000). Our gel-shift experiments led us to propose that the context of these divergent E-boxes, and not only the core sequence itself, is important in determining their efficacy for CLOCKBMAL1 binding. Indeed we show that E-boxes are less tolerant to variations in the core sequence than divergent E-boxes. These data suggest that CLOCKBMAL1 can regulates genes that are devoid of canonical E-boxes and suggest that the promoter sequences of putative target genes of CLOCKBMAL1 should be studied for divergent CACATG E-boxes with adjacent bases favorable for CLOCKBMAL1 binding. In that respect, we note that all the divergent E-box of the Rev-erb
contains a T at position 1. This TCACATG motif would be interesting to use in a bioinformatic search for putative CLOCKBMAL1 targets.
All the identified elements in the rat Rev-erb
promoter are conserved in the human and mouse sequences, stressing their functional relevance. In addition, we provide evidence suggesting that the structure of the P1 promoter and its regulation by CLOCKBMAL1 is also conserved in the zebrafish Rev-erb
gene, suggesting that Rev-erb
may be under the control of the master oscillator in vertebrate species that have been diverged for more than 300 million years. This conservation suggests that the role of Rev-erb
in circadian regulation is under strong positive selection and thus really important for the organisms fitness. This is in accordance with the circadian phenotype of the Rev-erb
-deficient mice. Experiments are under way in our laboratory to better delineate the role played by Rev-erb
and its paralogue Rev-erbß in circadian clocks in both mammals and zebrafish.
Although a similar response to CLOCKBMAL1 was observed for both Rev-erb
promoters, in agreement with the rhythmicity of both Rev-erb
transcripts, the serum-shock experiments suggest that these two promoters are differentially serum-regulated. It is likely that the transient and rapid differential regulation of P1 and P2 activities found after a serum shock is not the result of a circadian regulation but rather the action of serum-induced factors such as AP1. The basis for these different early effects of serum is unknown and may result from a promoter-specific response to growth factors. Of note, both P1 and P2 contain AP1 sites conserved between human and rodent promoters and it is possible that these sites do not respond identically to the serum treatment.
Multiple interlocked loops in circadian rhythm
Interestingly, a recent report shows that Rev-erb
mRNA accumulation is considerably advanced in Per2Brdm1 mutant mice, an observation that also suggests that Rev-erb
expression is under the control of the circadian pacemaker (Preitner et al. 2002). This report also demonstrates that Rev-erb
controls the cyclic expression of BMAL1, since in Rev-erb
-knockout mice BMAL1 expression remains constant. These data, together with our demonstration that Rev-erb
is a target of the molecular oscillator, suggest that Rev-erb
is part of a regulatory loop which plays an important role in generating circadian rhythm. This situation is reminiscent of the case of DBP, which is also controlled by the clock and able to regulate Clock gene expression (Ripperger et al. 2000, Yamaguchi et al. 2000; reviewed in Roenneberg & Merrow 2003). Interestingly, in the case of Rev-erb
, as for DBP, other closely related genes also appear to play a role in circadian rhythm (Fig. 10
). The three paralogues DBP, hepatic leukemia factor (HLF) and thyrotroph embryonic factor (TEF), which are all transcriptional activators, appear to cycle with identical phase, whereas the related gene, adenovirus E4 promoter-binding protein (E4 BP4), encoding a transcriptional repressor which does not contain the proline and acidic amino acid rich (PAR) activation domain, cycles in an opposite phase (Mitsui et al. 2001). E4 BP4 has been shown to compete with DBP, HLF and TEF for binding on the same DNA target sequences. In the case of Rev-erb
, it is interesting to observe that its paralog, Rev-erb
, also displays circadian expression, whereas two of the three closely related Retinoid-related Orphan Receptor (ROR) genes, RORß and ROR
, have been shown to cycle in brain and/or liver with a phase opposed to that of Rev-erb
(Andre et al. 1998, Panda et al. 2002, Preitner et al. 2002, Storch et al. 2002). RORs are transcriptional activators that bind to the same target sequence as Rev-erbs, namely the RevRE elements, and activate genes that are negatively regulated by Rev-erb
. Thus, DBP/E4 BP4 as well as RORs/Rev-erbs are paired components of a reciprocal mechanism that may complement each other in regulating the circadian oscillatory loop. It is also possible that other factors such as the basic helix-loop-helix transcription factors Differentially Expressed in Chondrocytes (DEC1) and DEC2, which both interact negatively with CLOCKBMAL1-mediated transcriptional activation, are also able to form another independent loop (Honma et al. 2002; reviewed in Roenneberg & Merrow 2003). From all these data it is tempting to speculate that these loops, regulating the central oscillator, are interconnected but this remains to be addressed experimentally.
|
as a model for integrating circadian and physiological regulation
Previous studies have shown that Rev-erb
gene expression is regulated by multiple signaling pathways. For instance, adipocyte differentiation and fibrates upregulate Rev-erb
expression while myocyte differentiation and glucocorticoids repress its expression (Chawla & Lazar 1993, Downes et al. 1995, Gervois et al. 1999, Torra et al. 2000). We already reported that Rev-erb
gene expression is inhibited by its own product as well as by the Rev-erbß gene product through a Rev-DR2 element located in the P1 promoter (Adelmant et al. 1996). This site also allows an upregulation of Rev-erb
by the related transcriptional activator orphan receptor, ROR
(Raspe et al. 2002). RORß is circadian in the mouse SCN and pineal gland and the corresponding knockout mice exhibit a circadian phenotype (Andre et al. 1998). ROR
expression is circadian in liver (Panda et al. 2002). We recently found that the second Rev-erb
promoter is also downregulated by Rev-erbs and activated by RORs through a monomeric RevRE (S Thenot and V Laudet, unpublished observations). The opposite phase of Rev-erb
and ROR gene expression suggests that the balance of their products is also regulated in a circadian manner and that this regulation might contribute to some of the circadian patterns of Rev-erb
expression in tissues such as the SCN, pineal gland and liver. The Rev-DR2 site, which is located in the P1 promoter and conserved in all mammals examined to date, is also the target for PPAR
, which mediates the biological effects of fibrates (Gervois et al. 1999). Interestingly, the PPAR
gene was also shown to be regulated according to a circadian rhythm with a peak at zeitgeber 10 (ZT10) (Lemberger et al. 1996). Finally, the P1 promoter is also downregulated by glucocorticoids through an unidentified non-Glucocorticoid Responsive Element (GRE) site (Torra et al. 2000). Plasma glucocorticoid levels oscillate with a peak around the onset of the activity phase and they participate in the glucocorticoid receptor-mediated resetting of peripheral clocks (Balsalobre et al. 2000, Le Minh et al. 2001).
Our finding that the CLOCKBMAL1 heterodimer is a positive regulator of Reverb
expression and that disruption of CLOCK activity in vitro and in vivo abolishes Rev-erb
circadian expression extends the repertoire of pathways that regulate Rev-erb
. Moreover, the data obtained with Clock mutant mice suggest that the circadian clock pacemaker is a master control point for Rev-erb
circadian expression. Furthermore, Rev-erb
circadian expression was observed in liver, heart and SCN suggesting that this gene is a critical output of the clock in multiple tissues (Panda et al. 2002, Storch et al. 2002; reviewed in Delaunay & Laudet 2002). How Rev-erb
integrates this circadian regulation with other regulatory pathways awaits further investigation. Interestingly, it was shown recently that the feeding schedule is a strong synchronizer of peripheral clocks (Damiola et al. 2000). The mechanisms by which the timing of food intake regulates peripheral clocks are still poorly understood, yet several hypotheses including roles for temperature and redox cofactors have been proposed (Rutter et al. 2001). The analysis of the mechanisms by which Rev-erb
integrates circadian and physiological inputs using mutant mice and nuclear receptor ligands will undoubtedly shed light on the function of circadian clocks.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Adelmant G, Begue A, Stehelin D & Laudet V 1996 A functional Rev-erb alpha responsive element located in the human Rev-erb alpha promoter mediates a repressing activity. PNAS 93 35533558.
Akashi M, Tsuchiya Y, Yoshino T & Nishida E 2002 Control of intracellular dynamics of mammalian period proteins by casein kinase I epsilon (CKIepsilon) and CKIdelta in cultured cells. Molecular and Cellular Biology 22 16931703.
Andre E, Conquet F, Steinmayr M, Stratton SC, Porciatti V & Becker-Andre M 1998 Disruption of retinoid-related orphan receptor beta changes circadian behavior, causes retinal degeneration and leads to vacillans phenotype in mice. EMBO Journal 17 38673877.[CrossRef][Web of Science][Medline]
Balsalobre A, Damiola F & Schibler U 1998 A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell 93 929937.[CrossRef][Web of Science][Medline]
Balsalobre A, Brown SA, Marcacci L, Tronche F, Kellendonk C, Reichardt HM, Schutz G & Schibler U 2000 Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Science 289 23442347.
Brown SA & Schibler U 1999 The ins and outs of circadian timekeeping. Current Opinion in Genetics and Development 9 588594.[CrossRef][Web of Science][Medline]
Chawla A & Lazar MA 1993 Induction of Rev-ErbA alpha, an orphan receptor encoded on the opposite strand of the alpha-thyroid hormone receptor gene, during adipocyte differentiation. Journal of Biological Chemistry 268 1626516269.
Chen W & Baler R 2000 The rat arylalkylamine N-acetyltransferase E-box differential use in a master vs a slave oscillator. Brain Research Molecular Brain Research 81 4350.[Medline]
Chong NW, Bernard M & Klein DC 2000 Characterization of the chicken serotonin N-acetyltransferase gene. Activation via clock gene heterodimer/E box interaction. Journal of Biological Chemistry 275 3299132998.
Crosio C, Cermakian N, Allis CD & Sassone-Corsi P 2000 Light induces chromatin modification in cells of the mammalian circadian clock. Nature Neuroscience 3 12411247.[CrossRef][Web of Science][Medline]
Damiola F, Le Minh N, Preitner N, Kornmann B, Fleury-Olela & Schibler U 2000 Restricted feeding uncouples circadian oscillators in peripheral tissues from the central pacemaker in the suprachiasmatic nucleus. Genes and Development 14 29502961.
Delaunay F & Laudet V 2002 Circadian clock and microarrays mammalian genome gets rhythm. Trends in Genetics 18 595597.[CrossRef][Web of Science][Medline]
Delaunay F, Thisse C, Marchand O, Laudet V & Thisse B 2000 An inherited functional circadian clock in zebrafish embryos. Science 289 297300.
Delaunay F, Thisse C, Thisse B & Laudet V 2003 Differential regulation of Period 2 and Period 3 expression during development of the zebrafish circadian clock. Gene Expression Patterns 3 319324.
Downes M, Carozzi AJ & Muscat GE 1995 Constitutive expression of the orphan receptor, Rev-erbA alpha, inhibits muscle differentiation and abrogates the expression of the myoD gene family. Molecular Endocrinology 9 16661678.
Dumas B, Harding HP, Choi HS, Lehmann KA, Chung M, Lazar MA & Moore DD 1994 A new orphan member of the nuclear hormone receptor superfamily closely related to Rev-Erb. Molecular Endocrinology 8 9961005.
Etchegaray JP, Lee C, Wade PA & Reppert SM 2003 Rhythmic histone acetylation underlies transcription in the mammalian circadian clock. Nature 421 177182.[CrossRef][Medline]
Foster RG 1998 Shedding light on the biological clock. Neuron 20 829832.[CrossRef][Web of Science][Medline]
Fruchart JC, Duriez P & Staels B 1999 Peroxisome proliferator-activated receptor-alpha activators regulate genes governing lipoprotein metabolism, vascular inflammation and atherosclerosis. Current Opinion in Lipidology 10 245257.[CrossRef][Web of Science][Medline]
Gamse JT, Shen Y-C, Thisse C, Thisse B, Raymond PA, Halpern ME & Liang JE 2002 Otx5 regulates genes that show circadian expression in the zebrafish pineal complex. Nature Genetics 30 117121.[CrossRef][Web of Science][Medline]
Gekakis N, Staknis D, Nguyen HB, Davis FC, Wilsbacher LD, King DP, Takahashi JS & Weitz CJ 1998 Role of the CLOCK protein in the mammalian circadian mechanism. Science 280 15641569.
Gervois P, Chopin-Delannoy S, Fadel A, Dubois G, Kosykh V, Fruchart JC, Najib J, Laudet V & Staels B 1999 Fibrates increase human REV-ERBalpha expression in liver via a novel peroxisome proliferator-activated receptor response element. Molecular Endocrinology 13 400409.
Grundschober C, Delaunay F, Puhlhofer A, Triqueneaux G, Laudet V, Bartfai T & Nef P 2001 Circadian regulation of diverse gene products revealed by mRNA expression profiling of synchronized fibroblasts. Journal of Biological Chemistry 276 4675146758.
Harding HP & Lazar MA 1995 The monomer-binding orphan receptor Rev-Erb represses transcription as a dimer on a novel direct repeat. Molecular and Cellular Biology 15 47914802.
Honma S, Kawamoto T, Takagi Y, Fujimoto K, Sato F, Noshiro M, Kato Y & Honma K 2002 Dec1 and Dec2 are regulators of the mammalian molecular clock. Nature 419 841844.[CrossRef][Medline]
Jin X, Shearman LP, Weaver DR, Zylka MJ, de Vries GJ & Reppert SM 1999 A molecular mechanism regulating rhythmic output from the suprachiasmatic circadian clock. Cell 96 5768.[CrossRef][Web of Science][Medline]
King DP, Zhao Y, Sangoram AM, Wilsbacher LD, Tanaka M, Antoch MP, Steeves TD, Vitaterna MH, Kornhauser JM, Lowrey PL, et al. 1997 Positional cloning of the mouse circadian clock gene. Cell 89 641653.[CrossRef][Web of Science][Medline]
Kume K, Zylka MJ, Sriram S, Shearman LP, Weaver DR, Jin X, Maywood ES, Hastings MH & Reppert SM 1999 mCRY1 and mCRY2 are essential components of the negative limb of the circadian clock feedback loop. Cell 98 193205.[CrossRef][Web of Science][Medline]
Laudet V & Gronemeyer H 2002 The nuclear receptors - Facts Book. San Diego, San Francisco, New York, Boston, London, Sydney, Tokyo Academic Press
Laudet V, Begue A, Henry-Duthoit C, Joubel A, Martin P, Stehelin D & Saule S 1991 Genomic organization of the human thyroid hormone receptor alpha (c-erbA-1) gene. Nucleic Acids Research 19 11051112.
Lazar MA, Hodin RA, Darling DS & Chin WW 1989 A novel member of the thyroid/steroid hormone receptor family is encoded by the opposite strand of the rat c-erbA alpha transcriptional unit. Molecular and Cellular Biology 9 11281136.
Lee C, Etchegaray JP, Cagampang FR, Loudon AS & Reppert SM 2001 Posttranslational mechanisms regulate the mammalian circadian clock. Cell 107 855867.[CrossRef][Web of Science][Medline]
Lemberger T, Saladin R, Vazquez M, Assimacopoulos F, Staels B, Desvergne B, Wahli W & Auwerx J 1996 Expression of the peroxisome proliferator-activated receptor alpha gene is stimulated by stress and follows a diurnal rhythm. Journal of Biological Chemistry 271 17641769.
Le Minh N, Damiola F, Tronche F, Schutz G & Schibler U 2001 Glucocorticoid hormones inhibit food-induced phase-shifting of peripheral circadian oscillators. EMBO Journal 20 71287136.[CrossRef][Web of Science][Medline]
Lowrey PL & Takahashi JS 2000 Genetics of the mammalian circadian system. Photic entrainment, circadian pacemaker mechanisms, and post-translational regulation. Annual Review of Genetics 34 533562.[CrossRef][Web of Science][Medline]
Mitsui S, Yamaguchi S, Matsuo T, Ishida Y & Okamura H 2001 Antagonistic role of E4 BP4 and PAR proteins in the circadian oscillatory mechanism. Genes and Development 15 9951006.
Miyajima N, Horiuchi R, Shibuya Y, Fukushige S, Matsubara K, Toyoshima K & Yamamoto T 1989 Two erbA homologs encoding proteins with different T3 binding capacities are transcribed from opposite DNA strands of the same genetic locus. Cell 57 3139.[CrossRef][Web of Science][Medline]
Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP & Conneely OM 2000 Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289 17511754.
Nasevicius A & Ekker SC 2000 Effective targeted gene knockdown in zebrafish. Nature Genetics 26 216220.[CrossRef][Web of Science][Medline]
Nuclear Receptors Nomenclature Committee 1999 A unified nomenclature system for the nuclear receptor superfamily. Cell 97 161163.[CrossRef][Web of Science][Medline]
Oishi K, Sakamoto K, Okada T, Nagase T & Ishida N 1998 Antiphase circadian expression between BMAL1 and period homologue mRNA in the suprachiasmatic nucleus and peripheral tissues of rats. Biochemical and Biophysical Research Communications 253 199203.[CrossRef][Web of Science][Medline]
Panda S, Antoch MP, Miller BH, Su AI, Schook AB, Straume M, Schultz PG, Kay SA, Takahashi JS & Hogenesch JB 2002 Coordinated transcription of key pathways in the mouse by the circadian clock. Cell 109 307320.[CrossRef][Web of Science][Medline]
Plautz JD, Kaneko M, Hall JC & Kay SA 1997 Independent photoreceptive circadian clocks throughout Drosophila. Science 278 16321635.
Preitner N, Damiola F, Lopez-Molina L, Zakany J, Duboule D, Albrecht U & Schibler U 2002 The orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 110 251260.[CrossRef][Web of Science][Medline]
Raspe E, Mautino G, Duval C, Fontaine C, Duez H, Barbier O, Monte D, Fruchart J, Fruchart JC & Staels B 2002 Transcriptional regulation of human Rev-erb alpha gene expression by the orphan nuclear receptor retinoic acid-related orphan receptor alpha. Journal of Biological Chemistry 277 4927549281.
Renaud JP, Harris JM, Downes M, Burke LJ & Muscat GE 2000 Structure-function analysis of the Rev-erbA and RVR ligand-binding domains reveals a large hydrophobic surface that mediates corepressor binding and a ligand cavity occupied by side chains. Molecular Endocrinology 14 700717.
Ripperger JA, Shearman LP, Reppert SM & Schibler U 2000 CLOCK, an essential pacemaker component, controls expression of the circadian transcription factor DBP. Genes and Development 14 679689.
Ripperger JA & Schibler U 2001 Circadian regulation of gene expression in animals. Current Opinion in Cell Biology 13 357362.[CrossRef][Web of Science][Medline]
Roenneberg T & Merrow M 2003 The network of time understanding the molecular circadian system. Current Biology 13 R198R207.[CrossRef][Web of Science][Medline]
Rutter J, Reick M, Wu LC & McKnight SL 2001 Regulation of clock and NPAS2 DNA binding by the redox state of NAD cofactors. Science 293 510514.
Shearman LP, Sriram S, Weaver, DR, Maywood ES, Chaves I, Zheng B, Kume K, Lee CC, van der Horst GT, Hastings MH & Reppert SM 2000 Interacting molecular loops in the mammalian circadian clock. Science 288 10131019.
Stokkan KA, Yamazaki S, Tei H, Sakaki Y & Menaker M 2001 Entrainment of the circadian clock in the liver by feeding. Science 291 490493.
Storch KF, Lipan O, Leykin I, Viswanathan N, Davis FC, Wong WH & Weitz CJ 2002 Extensive and divergent circadian gene expression in liver and heart. Nature 417 7883.[CrossRef][Medline]
Thisse C, Thisse B, Schilling TF & Postlethwait JH 1993 Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119 12031215.[Abstract]
Torra IP, Tsibulsky V, Delaunay F, Saladin R, Laudet V, Fruchart JC, Kosykh V & Staels, B. 2000 Circadian and glucocorticoid regulation of Rev-erb alpha expression in liver. Endocrinology 141 37993806.
Tosini G & Menaker M 1996 Circadian rhythms in cultured mammalian retina. Science 272 419421.[Abstract]
Vanacker JM, Pettersson K, Gustafsson JA & Laudet V 1999 Transcriptional targets shared by estrogen receptor-related receptors (ERRs) and estrogen receptor (ER) alpha, but not by ERbeta. EMBO Journal 18 42704279.[CrossRef][Web of Science][Medline]
Vielhaber EL, Duricka D, Ullman KS & Virshup DM 2001 Nuclear export of mammalian PERIOD proteins. Journal of Biological Chemistry 276 4592145927.
Vitaterna MH, King DP, Chang AM, Kornhauser JM, Lowrey PL, McDonald JD, Dove WF, Pinto LH, Turek FW & Takahashi JS 1994 Mutagenesis and mapping of a mouse gene, Clock, essential for circadian behavior. Science 264 719725.
Whitmore D, Foulkes NS, Strahle U & Sassone-Corsi P 1998 Zebrafish Clock rhythmic expression reveals independent peripheral circadian oscillators. Nature Neuroscience 1 701707.[CrossRef][Web of Science][Medline]
Yagita K, Tamanini F, van Der Horst GT & Okamura H 2001 Molecular mechanisms of the biological clock in cultured fibroblasts. Science 292 278281.
Yagita K, Tamanini F, Yasuda M, Hoeijmakers JH, van der Horst GT & Okamura H 2002 Nucleocytoplasmic shuttling and mCRY-dependent inhibition of ubiquitylation of the mPER2 clock protein. EMBO Journal 21 13011314.[CrossRef][Web of Science][Medline]
Yamaguchi S, Mitsui S, Yan L, Yagita K, Miyake S & Okamura H 2000 Role of DBP in the circadian oscillatory mechanism. Molecular and Cellular Biology 20 47734781.
Yamazaki S, Numano R, Abe M, Hida A, Takahashi R, Ueda M, Block GD, Sakaki Y, Menaker M & Tei H 2000 Resetting central and peripheral circadian oscillators in transgenic rats. Science 288 682685.
Young MW & Kay SA 2001 Time zones a comparative genetics of circadian clocks. Nature Review in Genetics 2 702715.
Zheng B, Albrecht U, Kaasik K, Sage M, Lu W, Vaishnav S, Li Q, Sun ZS, Eichele G, Bradley A & Lee CC 2001 Nonredundant roles of the mPer1 and mPer2 genes in the mammalian circadian clock. Cell 105 683694.[CrossRef][Web of Science][Medline]
Received 22 July 2004
Accepted 17 August 2004
This article has been cited by other articles:
![]() |
V. T. Vasu, C. E. Cross, and K. Gohil Nr1d1, an Important Circadian Pathway Regulatory Gene, Is Suppressed By Cigarette Smoke in Murine Lungs Integr Cancer Ther, December 1, 2009; 8(4): 321 - 328. [Abstract] [PDF] |
||||
![]() |
M. Teboul, A. Grechez-Cassiau, F. Guillaumond, and F. Delaunay How nuclear receptors tell time J Appl Physiol, December 1, 2009; 107(6): 1965 - 1971. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rambaud, G. Triqueneaux, I. Masse, B. Staels, V. Laudet, and G. Benoit Rev-erb{alpha}2 mRNA Encodes a Stable Protein with a Potential Role in Circadian Clock Regulation Mol. Endocrinol., May 1, 2009; 23(5): 630 - 639. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.M. Fustin, J.S. O'Neill, M.H. Hastings, D.G. Hazlerigg, and H. Dardente Cry1 Circadian Phase in vitro: Wrapped Up with an E-Box J Biol Rhythms, February 1, 2009; 24(1): 16 - 24. [Abstract] [PDF] |
||||
![]() |
M. Teboul, F. Guillaumond, A. Grechez-Cassiau, and F. Delaunay Minireview: The Nuclear Hormone Receptor Family Round the Clock Mol. Endocrinol., December 1, 2008; 22(12): 2573 - 2582. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. J. Meng, A. McMaster, S. Beesley, W. Q. Lu, J. Gibbs, D. Parks, J. Collins, S. Farrow, R. Donn, D. Ray, et al. Ligand modulation of REV-ERB{alpha} function resets the peripheral circadian clock in a phasic manner J. Cell Sci., November 1, 2008; 121(21): 3629 - 3635. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hummasti and P. Tontonoz Adopting New Orphans into the Family of Metabolic Regulators Mol. Endocrinol., August 1, 2008; 22(8): 1743 - 1753. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fontaine, E. Rigamonti, B. Pourcet, H. Duez, C. Duhem, J.-C. Fruchart, G. Chinetti-Gbaguidi, and B. Staels The Nuclear Receptor Rev-erb{alpha} Is a Liver X Receptor (LXR) Target Gene Driving a Negative Feedback Loop on Select LXR-Induced Pathways in Human Macrophages Mol. Endocrinol., August 1, 2008; 22(8): 1797 - 1811. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. P. Burris Nuclear Hormone Receptors for Heme: REV-ERB{alpha} and REV-ERB{beta} Are Ligand-Regulated Components of the Mammalian Clock Mol. Endocrinol., July 1, 2008; 22(7): 1509 - 1520. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Duez and B. Staels The nuclear receptors Rev-erbs and RORs integrate circadian rhythms and metabolism Diabetes and Vascular Disease Research, June 1, 2008; 5(2): 82 - 88. [Abstract] [PDF] |
||||
![]() |
A. Grechez-Cassiau, B. Rayet, F. Guillaumond, M. Teboul, and F. Delaunay The Circadian Clock Component BMAL1 Is a Critical Regulator of p21WAF1/CIP1 Expression and Hepatocyte Proliferation J. Biol. Chem., February 22, 2008; 283(8): 4535 - 4542. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cai, J. Rambaud, M. Teboul, I. Masse, G. Benoit, J.-A. Gustafsson, F. Delaunay, V. Laudet, and I. Pongratz Expression Levels of Estrogen Receptor Are Modulated by Components of the Molecular Clock Mol. Cell. Biol., January 15, 2008; 28(2): 784 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-i. Nishio, T. Kakizawa, G. Chatelain, G. Triqueneaux, F. Brunet, J. Rambaud, T. Lamonerie, and V. Laudet OTX5 Regulates Pineal Expression of the Zebrafish REV-ERB{alpha} through a New DNA Binding Site Mol. Endocrinol., January 1, 2008; 22(1): 23 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kakizawa, S.-i. Nishio, G. Triqueneaux, S. Bertrand, J. Rambaud, and V. Laudet Two differentially active alternative promoters control the expression of the zebrafish orphan nuclear receptor gene Rev-erb{alpha} J. Mol. Endocrinol., May 1, 2007; 38(5): 555 - 568. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Benoit, A. Cooney, V. Giguere, H. Ingraham, M. Lazar, G. Muscat, T. Perlmann, J.-P. Renaud, J. Schwabe, F. Sladek, et al. International Union of Pharmacology. LXVI. Orphan Nuclear Receptors Pharmacol. Rev., December 1, 2006; 58(4): 798 - 836. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Ko and J. S. Takahashi Molecular components of the mammalian circadian clock Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R271 - R277. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Canaple, J. Rambaud, O. Dkhissi-Benyahya, B. Rayet, N. S. Tan, L. Michalik, F. Delaunay, W. Wahli, and V. Laudet Reciprocal Regulation of Brain and Muscle Arnt-Like Protein 1 and Peroxisome Proliferator-Activated Receptor {alpha} Defines a Novel Positive Feedback Loop in the Rodent Liver Circadian Clock Mol. Endocrinol., August 1, 2006; 20(8): 1715 - 1727. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shimba, N. Ishii, Y. Ohta, T. Ohno, Y. Watabe, M. Hayashi, T. Wada, T. Aoyagi, and M. Tezuka Brain and muscle Arnt-like protein-1 (BMAL1), a component of the molecular clock, regulates adipogenesis PNAS, August 23, 2005; 102(34): 12071 - 12076. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Appelbaum, A. Anzulovich, R. Baler, and Y. Gothilf Homeobox-Clock Protein Interaction in Zebrafish: A SHARED MECHANISM FOR PINEAL-SPECIFIC AND CIRCADIAN GENE EXPRESSION J. Biol. Chem., March 25, 2005; 280(12): 11544 - 11551. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |